ASV Sequence GBOL_ASV_ID_80758
Date added | 2022-10-17 19:50:00 |
Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_410 |
Primers | fwhF2, Fol-degen-rev |
TTTATCTTCTAATATCGCTCATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACCACTGTAATTAATATACGATCAACAGGAATCACATTTGACCGAATACCTTTATTTGTTTGATCGGTAGTAATTACAGCCTTATTACTTCTATTATCATTACCAGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAACATTAATACTTCATTTTTCGATCCAGCAGGAGGAGGAGACCCTATCCTATACCAACATTTATTC
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Bellardia vulgaris (Robineau-Desvoidy, 1830) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Calliphoridae, Bellardia, Bellardia vulgaris (Robineau-Desvoidy, 1830) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
Bellardia viarum (Robineau-Desvoidy, 1830) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Calliphoridae, Bellardia, Bellardia viarum (Robineau-Desvoidy, 1830) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
Bellardia vulgaris | BOLD | Arthropoda, Insecta, Diptera, Calliphoridae, Calliphorinae, Bellardia, Bellardia vulgaris | 100.0000 | 2022-10-17 22:50:42 | |
Bellardia vulgaris | BOLD | Arthropoda, Insecta, Diptera, Calliphoridae, Calliphorinae, Bellardia, Bellardia vulgaris | 100.0000 | 2023-09-01 09:07:40 | |
Bellardia vulgaris (Robineau-Desvoidy, 1830) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Calliphoridae, Bellardia, Bellardia vulgaris (Robineau-Desvoidy, 1830) | 100.0000 | 0E-8 | 2025-07-06 16:38:03 |
Occurrences |
Total of 3088 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 3088 occurrences in 69 samples: ASV table 40 version 2 Download Total of 2926 occurrences in 30 samples: ASV table 42 version 1 Download Total of 2926 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 2926 occurrences in 30 samples: ASV table 42 version 3 Download Total of 2926 occurrences in 30 samples: ASV table 42 version 4 Download Total of 3088 occurrences in 69 samples: ASV table 40 version 3 Download |