ASV Sequence GBOL_ASV_ID_80740

Date added 2022-10-17 19:50:00
Provided in projects: Project: Pooling Malaise trap fractions with original sequence id: OTU_1786
Primers
fwhF2, Fol-degen-rev

CCTTTCATCAACATTATCCCACTCTGGTGCATCTGTAGATTTATCAATCTTCTCTCTTCACTTAGCTGGAATTTCATCCATTTTAGGGGCAGTAAACTTTATTTCTACTATTATTAATATACGGACCCCAGGGATATTTTTTGATAAAATACCCTTATTTGTCTGATCAGTTTTAATTACAGCTATTTTATTATTACTATCTTTACCAGTATTAGCGGGAGCTATTACAATACTTTTAACTGATCGAAACCTAAATACTTCATTCTTTGACCCTGCGGGAGGAGGGGACCCTATTTTATATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Leptosciarella trochanterata (Zetterstedt, 1851) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae, Leptosciarella, Leptosciarella, Leptosciarella trochanterata (Zetterstedt, 1851) 99.0000 0E-8 2022-10-17 22:50:42
Leptosciarella trochanterata Zetterstedt, 1851 BOLD Arthropoda, Insecta, Diptera, Sciaridae, Leptosciarella, Leptosciarella trochanterata Zetterstedt, 1851 99.0000 2022-10-17 22:50:42
Leptosciarella trochanterata Zetterstedt, 1851 BOLD Arthropoda, Insecta, Diptera, Sciaridae, Leptosciarella, Leptosciarella trochanterata Zetterstedt, 1851 100.0000 2022-10-17 22:50:42
Leptosciarella trochanterata (Zetterstedt, 1851) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae, Leptosciarella, Leptosciarella, Leptosciarella trochanterata (Zetterstedt, 1851) 99.0000 0E-8 2023-09-01 09:07:40
Leptosciarella trochanterata Zetterstedt, 1851 BOLD Arthropoda, Insecta, Diptera, Sciaridae, Leptosciarella, Leptosciarella trochanterata Zetterstedt, 1851 100.0000 2023-09-01 09:07:40

Occurrences Total of 331 occurrences in 69 samples: ASV table 40 version 1 Download
Total of 331 occurrences in 69 samples: ASV table 40 version 2 Download
Total of 65 occurrences in 30 samples: ASV table 42 version 1 Download
Total of 65 occurrences in 30 samples: ASV table 42 version 2 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download
Total of 65 occurrences in 30 samples: ASV table 42 version 3 Download
Total of 65 occurrences in 30 samples: ASV table 42 version 4 Download
Total of 331 occurrences in 69 samples: ASV table 40 version 3 Download