ASV Sequence GBOL_ASV_ID_80709
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_2784 Project: AMMOD I with original sequence id: 8a477e8e32a50940a1f7fa01f29c1b1f |
| Primers | fwhF2, Fol-degen-rev |
TTATCTTCATATTCATACCACCCATCTTCGTCAGTTGATTTAAAAATTTGTTCGCTACATATTGCAGGAATTTCATACATTATAGGAGCGATTAACTTCATTGTAACAATTTTAAATATAAAAAATATTTCAATAAACTATGATCAATTACCACTATTCCCCTGATCAGTATTTATCACCACAATTCTATTATTAATTTCCGTACCAGTTTTAGCCGGAGCTATTACAATGTTATTATCAGATCGTAATTTAAATTCATCGTTCTTCGATCCAATAGGAGGAGGAGATCCCATTCTATACCAACACCTATTC
Currently, no taxa have been assigned
| Occurrences |
Total of 101 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 101 occurrences in 69 samples: ASV table 40 version 2 Download Total of 53 occurrences in 30 samples: ASV table 42 version 1 Download Total of 53 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 53 occurrences in 30 samples: ASV table 42 version 3 Download Total of 53 occurrences in 30 samples: ASV table 42 version 4 Download Total of 30 occurrences in 5 samples: ASV table 115 version 1 Download Total of 101 occurrences in 69 samples: ASV table 40 version 3 Download |