ASV Sequence GBOL_ASV_ID_80693

Date added 2022-10-17 19:50:00
Provided in projects: Project: Pooling Malaise trap fractions with original sequence id: OTU_804
Primers
fwhF2, Fol-degen-rev

TTTATCTTTAAATATCAACCATGAAGGTATATCAATTGATTTAACAATTTTTTCTCTACACTTAGCTGGTATATCATCTATTATAGGAGCAATTAATTTTATTACTACTATTATAAATATATTCCCTTTAATAACTAAAATAAATCAATTAACTTTATTTAATTGATCAATCTTAATTACCACAATTCTTTTATTATTAGCAGTTCCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGACCGAAATTTAAATACATCATTTTTTGACCCATCAGGAGGGGGTGACCCAATTTTATATCAACATCTTTTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Theroscopus pedestris (Fabricius, 1775) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae, Theroscopus, Theroscopus pedestris (Fabricius, 1775) 100.0000 0E-8 2022-10-17 22:50:42
Theroscopus pedestris Fabricius, 1775 BOLD Arthropoda, Insecta, Hymenoptera, Ichneumonidae, Cryptinae, Theroscopus, Theroscopus pedestris Fabricius, 1775 100.0000 2022-10-17 22:50:42
Theroscopus pedestris Fabricius, 1775 BOLD Arthropoda, Insecta, Hymenoptera, Ichneumonidae, Cryptinae, Theroscopus, Theroscopus pedestris Fabricius, 1775 100.0000 2023-05-17 15:55:15
Theroscopus pedestris (Fabricius, 1775) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae, Theroscopus, Theroscopus pedestris (Fabricius, 1775) 100.0000 0E-8 2023-09-01 09:07:40
Theroscopus pedestris Fabricius, 1775 BOLD Arthropoda, Insecta, Hymenoptera, Ichneumonidae, Phygadeuontinae, Theroscopus, Theroscopus pedestris Fabricius, 1775 100.0000 2023-09-01 09:07:40

Occurrences Total of 1218 occurrences in 69 samples: ASV table 40 version 1 Download
Total of 1218 occurrences in 69 samples: ASV table 40 version 2 Download
Total of 875 occurrences in 30 samples: ASV table 42 version 1 Download
Total of 875 occurrences in 30 samples: ASV table 42 version 2 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download
Total of 875 occurrences in 30 samples: ASV table 42 version 3 Download
Total of 875 occurrences in 30 samples: ASV table 42 version 4 Download
Total of 1218 occurrences in 69 samples: ASV table 40 version 3 Download