ASV Sequence GBOL_ASV_ID_80679
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_558 |
| Primers |
fwhF2, Fol-degen-rev |
ACTCTCAGCTAATATTGCTCATGCAGGAGCTTCTGTTGATTTAGCAATTTTTAGCCTACACTTAGCGGGAGTATCCTCAATTTTAGGTGCGGTTAATTTTATTACTACTGTAATTAATATACGATTAAATTATATAACATTAGACCGTATACCTTTATTTGTTTGATCTGTAGTAATTACTGCCTTATTATTATTATTATCTCTACCTGTATTAGCAGGAGCTATTACAATATTATTAACAGACCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGGGGAGGAGACCCTATTCTTTATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Wesmaelius nervosus Fabricius, 1793 | BOLD | Arthropoda, Insecta, Neuroptera, Hemerobiidae, Hemerobiinae, Wesmaelius, Wesmaelius nervosus Fabricius, 1793 | 100.0000 | 2022-10-17 22:50:42 | |
| Wesmaelius nervosus Fabricius, 1793 | BOLD | Arthropoda, Insecta, Neuroptera, Hemerobiidae, Hemerobiinae, Wesmaelius, Wesmaelius nervosus Fabricius, 1793 | 99.0000 | 2022-10-17 22:50:42 | |
| Wesmaelius nervosus (Fabricius, 1793) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Neuroptera, Hemerobiidae, Wesmaelius, Wesmaelius nervosus (Fabricius, 1793) | 100.0000 | 0E-8 | 2023-09-01 09:07:40 |
| Wesmaelius nervosus Fabricius, 1793 | BOLD | Arthropoda, Insecta, Neuroptera, Hemerobiidae, Hemerobiinae, Wesmaelius, Wesmaelius nervosus Fabricius, 1793 | 100.0000 | 2023-09-01 09:07:40 | |
| Wesmaelius nervosus (Fabricius, 1793) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Neuroptera, Hemerobiidae, Wesmaelius, Wesmaelius nervosus (Fabricius, 1793) | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 2068 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 2068 occurrences in 69 samples: ASV table 40 version 2 Download Total of 2054 occurrences in 30 samples: ASV table 42 version 1 Download Total of 2054 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 2054 occurrences in 30 samples: ASV table 42 version 3 Download Total of 2054 occurrences in 30 samples: ASV table 42 version 4 Download Total of 2068 occurrences in 69 samples: ASV table 40 version 3 Download |