ASV Sequence GBOL_ASV_ID_80658

Date added 2022-10-17 19:50:00
Provided in projects: Project: Pooling Malaise trap fractions with original sequence id: OTU_974
Primers
fwhF2, Fol-degen-rev

CCTTTCCTCAAATATTGCACACGGGGGGGCTTCTGTTGATCTTGCTATTTTTTCGTTACACTTAGCAGGGGCTTCATCTATCTTAGGGGCAGTAAATTTTATTACTACAATTATTAATATGCGCTCTTCTGGGATTACTTTTGATCGAATACCCTTATTCGTTTGATCTGTATTAATTACCGCCGTACTATTACTATTATCTTTACCCGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTTAATACATCCTTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTTTATCAACACCTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Cerodontha denticornis Panzer, 1806 BOLD Arthropoda, Insecta, Diptera, Agromyzidae, Phytomyzinae, Cerodontha, Cerodontha denticornis Panzer, 1806 100.0000 2022-10-17 22:50:42
Cerodontha denticornis (Panzer, 1806) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Agromyzidae, Cerodontha, Cerodontha denticornis (Panzer, 1806) 100.0000 0E-8 2023-09-01 09:07:40
Cerodontha denticornis Panzer, 1806 BOLD Arthropoda, Insecta, Diptera, Agromyzidae, Phytomyzinae, Cerodontha, Cerodontha denticornis Panzer, 1806 100.0000 2023-09-01 09:07:40
Cerodontha denticornis (Panzer, 1806) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Agromyzidae, Cerodontha, Cerodontha denticornis (Panzer, 1806) 100.0000 0E-8 2025-12-04 21:49:01

Occurrences Total of 1049 occurrences in 69 samples: ASV table 40 version 1 Download
Total of 1049 occurrences in 69 samples: ASV table 40 version 2 Download
Total of 930 occurrences in 30 samples: ASV table 42 version 1 Download
Total of 930 occurrences in 30 samples: ASV table 42 version 2 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download
Total of 930 occurrences in 30 samples: ASV table 42 version 3 Download
Total of 930 occurrences in 30 samples: ASV table 42 version 4 Download
Total of 1049 occurrences in 69 samples: ASV table 40 version 3 Download