ASV Sequence GBOL_ASV_ID_80647
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1824 Project: AMMOD I with original sequence id: ca6edfd60751d2b0da58c9654bc1bd25 |
| Primers |
fwhF2, Fol-degen-rev |
ATTATCTCTAAATATTAATCATGAAGGTTTATCTGTTGATATAGCTATTTTCTCCCTTCATTTAGCTGGTATATCGTCTATTATAGGTGCAATTAACTTTATTACTACTATTTTAAATATATCCCCTTTAAATTCAAAATTTGATCAACTAACTTTATTTTCTTGATCTATCTTAATTACTACAATTCTTTTACTATTAGCTGTACCCGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGACCCCTCAGGAGGAGGTGATCCCATTTTATACCAACATCTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Ichneumonidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae | 100.0000 | 0E-8 | 2025-07-31 20:35:36 |
| Ichneumonidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 293 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 293 occurrences in 69 samples: ASV table 40 version 2 Download Total of 149 occurrences in 30 samples: ASV table 42 version 1 Download Total of 149 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 149 occurrences in 30 samples: ASV table 42 version 3 Download Total of 149 occurrences in 30 samples: ASV table 42 version 4 Download Total of 37 occurrences in 5 samples: ASV table 115 version 1 Download Total of 293 occurrences in 69 samples: ASV table 40 version 3 Download |