ASV Sequence GBOL_ASV_ID_80647

Date added 2022-10-17 19:50:00
Provided in projects: Project: Pooling Malaise trap fractions with original sequence id: OTU_1824
Project: AMMOD I with original sequence id: ca6edfd60751d2b0da58c9654bc1bd25
Primers
fwhF2, Fol-degen-rev

ATTATCTCTAAATATTAATCATGAAGGTTTATCTGTTGATATAGCTATTTTCTCCCTTCATTTAGCTGGTATATCGTCTATTATAGGTGCAATTAACTTTATTACTACTATTTTAAATATATCCCCTTTAAATTCAAAATTTGATCAACTAACTTTATTTTCTTGATCTATCTTAATTACTACAATTCTTTTACTATTAGCTGTACCCGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGACCCCTCAGGAGGAGGTGATCCCATTTTATACCAACATCTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Ichneumonidae GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae 100.0000 0E-8 2022-10-17 22:50:42
Ichneumonidae GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae 100.0000 0E-8 2025-07-31 20:35:36

Occurrences Total of 293 occurrences in 69 samples: ASV table 40 version 1 Download
Total of 293 occurrences in 69 samples: ASV table 40 version 2 Download
Total of 149 occurrences in 30 samples: ASV table 42 version 1 Download
Total of 149 occurrences in 30 samples: ASV table 42 version 2 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download
Total of 149 occurrences in 30 samples: ASV table 42 version 3 Download
Total of 149 occurrences in 30 samples: ASV table 42 version 4 Download
Total of 37 occurrences in 5 samples: ASV table 115 version 1 Download
Total of 293 occurrences in 69 samples: ASV table 40 version 3 Download