ASV Sequence GBOL_ASV_ID_80646
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1574 Project: AMMOD I with original sequence id: da0d5ae920468bee1317048350680aa7 |
| Primers |
fwhF2, Fol-degen-rev |
TTTATCTTCAAATTTAGGTCATCCTGGAATTTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGAGGGATCTCCTCAATTTTAGGTTCAATTAATTTTATTACAACAATTTTAAATATACGTCCTAAAAATATAACTATAGATAAAATTTCTTTATTTGTTTGATCAATTTTTTTAACAACAATTTTATTACTATTATCTCTTCCTGTTTTAGCAGGAGGAATTACGATATTATTATTTGATCGTAATTTAAATACCTCATTTTTTGATCCAATAGGGGGAGGGGACCCAATTTTATATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Alloxysta | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Figitidae, Alloxysta | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Alloxysta ramulifera | BOLD | Arthropoda, Insecta, Hymenoptera, Figitidae, Charipinae, Alloxysta, Alloxysta ramulifera | 100.0000 | 2022-10-17 22:50:42 | |
| Alloxysta ramulifera | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Figitidae, Alloxysta, Alloxysta ramulifera | 100.0000 | 0E-8 | 2023-09-01 09:07:40 |
| Alloxysta ramulifera | BOLD | Arthropoda, Insecta, Hymenoptera, Figitidae, Charipinae, Alloxysta, Alloxysta ramulifera | 100.0000 | 2023-09-01 09:07:40 | |
| Alloxysta ramulifera | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Figitidae, Charipinae, Alloxysta, Alloxysta ramulifera | 100.0000 | 0E-8 | 2025-12-04 21:49:01 |
| Occurrences |
Total of 340 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 340 occurrences in 69 samples: ASV table 40 version 2 Download Total of 46 occurrences in 30 samples: ASV table 42 version 1 Download Total of 46 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 46 occurrences in 30 samples: ASV table 42 version 3 Download Total of 46 occurrences in 30 samples: ASV table 42 version 4 Download Total of 5 occurrences in 5 samples: ASV table 115 version 1 Download Total of 340 occurrences in 69 samples: ASV table 40 version 3 Download |