ASV Sequence GBOL_ASV_ID_80630
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_2061 |
| Primers |
fwhF2, Fol-degen-rev |
ATTATCCCTTAATATTAATCATGAAGGAATATCTGTAGATTTAAGAATTTTTGCTCTTCATCTTGCTGGGATATCTTCAATTATAGGTGCTATTAATTTTATTACAACTATTCTAAATATAAAAATTAAAATTTTATCTCTTGAACAATTAACATTATTTACTTGATCAATTCAAATTACTGCAATTCTACTTCTTTTAGCTGTTCCAGTTCTAGCTGGTGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCTTTCTTTGACCCTATAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Exochus pictus Holmgren, 1858 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae, Exochus, Exochus pictus Holmgren, 1858 | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Exochus pictus Holmgren, 1858 | BOLD | Arthropoda, Insecta, Hymenoptera, Ichneumonidae, Metopiinae, Exochus, Exochus pictus Holmgren, 1858 | 100.0000 | 2022-10-17 22:50:42 | |
| Exochus semilividus van Vollenhoven, 1875 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae, Exochus, Exochus semilividus van Vollenhoven, 1875 | 100.0000 | 0E-8 | 2023-09-01 09:07:40 |
| Exochus pictus Holmgren, 1858 | BOLD | Arthropoda, Insecta, Hymenoptera, Ichneumonidae, Metopiinae, Exochus, Exochus pictus Holmgren, 1858 | 100.0000 | 2023-09-01 09:07:40 | |
| Exochus semilividus van Vollenhoven, 1875 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae, Exochus, Exochus semilividus van Vollenhoven, 1875 | 100.0000 | 0E-8 | 2025-12-04 21:49:01 |
| Ichneumonidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Ichneumonidae | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 200 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 200 occurrences in 69 samples: ASV table 40 version 2 Download Total of 108 occurrences in 30 samples: ASV table 42 version 1 Download Total of 108 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 108 occurrences in 30 samples: ASV table 42 version 3 Download Total of 108 occurrences in 30 samples: ASV table 42 version 4 Download Total of 200 occurrences in 69 samples: ASV table 40 version 3 Download |