ASV Sequence GBOL_ASV_ID_80624
Date added | 2022-10-17 19:50:00 |
Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_317 |
Primers | fwhF2, Fol-degen-rev |
TTTATCATCAAACCTAACCCATTCAGGAGCATCTGTTGATCTATCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGGGCAGTAAATTTTATCTCAACAATTATTAATATACAAATACCTGGTATAATATTTAATAAATTACCTTTATTCGTTTGATCAGTTTTAATTACTGCAATCTTACTACTTATTTCTTTACCAGTATTAGCCGGAGCAATTACTATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCGGCGGGAGGAGGGGATCCTATCTTATACCAACATTTATTT
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Leptosciarella subpilosa (Edwards, 1925) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae, Leptosciarella, Leptosciarella, Leptosciarella subpilosa (Edwards, 1925) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
Leptosciarella subpilosa Edwards, 1925 | BOLD | Arthropoda, Insecta, Diptera, Sciaridae, Leptosciarella, Leptosciarella subpilosa Edwards, 1925 | 100.0000 | 2022-10-17 22:50:42 | |
Leptosciarella subpilosa Edwards, 1925 | BOLD | Arthropoda, Insecta, Diptera, Sciaridae, Leptosciarella, Leptosciarella subpilosa Edwards, 1925 | 100.0000 | 2023-09-01 09:07:40 | |
Leptosciarella subpilosa (Edwards, 1925) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae, Leptosciarella, Leptosciarella, Leptosciarella subpilosa (Edwards, 1925) | 100.0000 | 0E-8 | 2025-07-06 16:38:03 |
Occurrences |
Total of 4480 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 4480 occurrences in 69 samples: ASV table 40 version 2 Download Total of 4161 occurrences in 30 samples: ASV table 42 version 1 Download Total of 4161 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 4161 occurrences in 30 samples: ASV table 42 version 3 Download Total of 4161 occurrences in 30 samples: ASV table 42 version 4 Download Total of 4480 occurrences in 69 samples: ASV table 40 version 3 Download |