ASV Sequence GBOL_ASV_ID_80621
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_850 |
| Primers |
fwhF2, Fol-degen-rev |
TTTATCATCTACTATTGCTCACAGAGGAGCATCTGTTGATCTAGCAATTTTTAGTCTTCATTTAGCAGGAGTATCATCAATTCTTGGTGCAGTAAATTTTATTACTACAGTTATTAATATGCGAACAGAAGGAATATCATTTGATCGAATACCCTTGTTTGTTTGATCAGTATTAATTACTGCTCTTCTACTATTACTCTCTCTTCCTGTTTTAGCTGGAGCAATCACAATACTTTTAACAGACCGAAATTTAAATACATCCTTCTTTGACCCAGCTGGAGGAGGGGATCCTATTCTTTATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Sicus ferrugineus Linnaeus, 1761 | BOLD | Arthropoda, Insecta, Diptera, Conopidae, Sicinae, Sicus, Sicus ferrugineus Linnaeus, 1761 | 100.0000 | 2022-10-17 22:50:42 | |
| Sicus ferrugineus Linnaeus, 1761 | BOLD | Arthropoda, Insecta, Diptera, Conopidae, Sicinae, Sicus, Sicus ferrugineus Linnaeus, 1761 | 100.0000 | 2024-01-19 19:50:35 | |
| Sicus ferrugineus (Linnaeus, 1761) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Conopidae, Sicus, Sicus ferrugineus (Linnaeus, 1761) | 100.0000 | 0E-8 | 2024-04-29 12:57:03 |
| Sicus ferrugineus (Linnaeus, 1761) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Conopidae, Sicus, Sicus ferrugineus (Linnaeus, 1761) | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 1229 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 1229 occurrences in 69 samples: ASV table 40 version 2 Download Total of 1006 occurrences in 30 samples: ASV table 42 version 1 Download Total of 1006 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 1006 occurrences in 30 samples: ASV table 42 version 3 Download Total of 1006 occurrences in 30 samples: ASV table 42 version 4 Download Total of 1229 occurrences in 69 samples: ASV table 40 version 3 Download |