ASV Sequence GBOL_ASV_ID_80616

Date added 2022-10-17 19:50:00
Provided in projects: Project: Pooling Malaise trap fractions with original sequence id: OTU_1926
Primers
fwhF2, Fol-degen-rev

TTTATCATTAAATTTAAGTCATTCTGGTATATCCGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGGATATCTTCTATTATAGGTGCTATTAATTTTATTTCTACTATTTTAAATATACGTTTATTAGGAATAAAAATAGATAATATTTCTTTATTTATTTGATCAGTTAATATTACGGCGGTATTATTGTTATTATCCTTACCAGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCATCTGGAGGTGGGGATCCAATTTTATATCAGCATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Leiophron pallidistigma BOLD Arthropoda, Insecta, Hymenoptera, Braconidae, Euphorinae, Leiophron, Leiophron pallidistigma 100.0000 2022-10-17 22:50:42
Leiophron pallidistigma GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Braconidae, Leiophron, Leiophron pallidistigma 100.0000 0E-8 2023-09-01 09:07:40
Leiophron pallidistigma BOLD Arthropoda, Insecta, Hymenoptera, Braconidae, Euphorinae, Leiophron, Leiophron pallidistigma 100.0000 2023-09-01 09:07:40
Leiophron pallidistigma GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Braconidae, Leiophron, Leiophron pallidistigma 100.0000 0E-8 2025-12-05 00:00:47

Occurrences Total of 233 occurrences in 69 samples: ASV table 40 version 1 Download
Total of 233 occurrences in 69 samples: ASV table 40 version 2 Download
Total of 170 occurrences in 30 samples: ASV table 42 version 1 Download
Total of 170 occurrences in 30 samples: ASV table 42 version 2 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download
Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download
Total of 170 occurrences in 30 samples: ASV table 42 version 3 Download
Total of 170 occurrences in 30 samples: ASV table 42 version 4 Download
Total of 233 occurrences in 69 samples: ASV table 40 version 3 Download