ASV Sequence GBOL_ASV_ID_80565
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1005 |
| Primers | fwhF2, Fol-degen-rev |
ACTATCTTCTAATATTGCCCACAGAGGAAGATCAGTTGACTTAGCCATTTTCTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATAAAATTAAATAATTTAATATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCTGGGGCTATCACAATACTTTTAACAGATCGAAATTTAAATACATCATTCTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATACCAACACTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Ochromolopis ictella (Hübner, 1813) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Lepidoptera, Epermenioidea, Epermeniidae, Ochromolopinae, Ochromolopis, Ochromolopis, Ochromolopis ictella (Hübner, 1813) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Ochromolopis ictella Hübner, 1813 | BOLD | Arthropoda, Insecta, Lepidoptera, Epermeniidae, Ochromolopinae, Ochromolopis, Ochromolopis ictella Hübner, 1813 | 100.0000 | 2022-10-17 22:50:42 | |
| Ochromolopis zagulajevi | BOLD | Arthropoda, Insecta, Lepidoptera, Epermeniidae, Ochromolopinae, Ochromolopis, Ochromolopis zagulajevi | 100.0000 | 2022-10-17 22:50:42 | |
| Ochromolopis ictella Hübner, 1813 | BOLD | Arthropoda, Insecta, Lepidoptera, Epermeniidae, Ochromolopinae, Ochromolopis, Ochromolopis ictella Hübner, 1813 | 100.0000 | 2023-09-01 09:07:40 | |
| Ochromolopis ictella (Hübner, 1813) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Lepidoptera, Epermenioidea, Epermeniidae, Ochromolopinae, Ochromolopis, Ochromolopis, Ochromolopis ictella (Hübner, 1813) | 100.0000 | 0E-8 | 2025-01-15 14:08:50 |
| Occurrences |
Total of 873 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 873 occurrences in 69 samples: ASV table 40 version 2 Download Total of 379 occurrences in 30 samples: ASV table 42 version 1 Download Total of 379 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 379 occurrences in 30 samples: ASV table 42 version 3 Download Total of 379 occurrences in 30 samples: ASV table 42 version 4 Download Total of 873 occurrences in 69 samples: ASV table 40 version 3 Download |