ASV Sequence GBOL_ASV_ID_80551
Date added | 2022-10-17 19:50:00 |
Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1072 |
Primers | fwhF2, Fol-degen-rev |
TCTATCTTCTAATATTGCTCATTCTGGGCCAAGAGTAGACCTAGCTATTTTTTCATTGCATTTAGCTGGAATTTCATCAATCCTAGGAGCAGTTAATTTTATTACCACAGTAATTAATATACGTTCTCCTGGAATAACCTTCGATCAAACTCCTTTATTTGTTTGATCTGTTCTAATTACTGCAGTATTATTATTACTTTCATTACCTGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGTAACCTTAATACATCATTTTTTGATCCATCAGGCGGCGGGGACCCAATTTTATATCAACATTTATTT
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Balcanocerus larvatus (Herrich-Schäffer, 1835) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Auchenorrhyncha, Cicadomorpha, Cicadellidae, Balcanocerus, Balcanocerus larvatus (Herrich-Schäffer, 1835) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
Balcanocerus larvatus | BOLD | Arthropoda, Insecta, Hemiptera, Cicadellidae, Eurymelinae, Balcanocerus, Balcanocerus larvatus | 100.0000 | 2022-10-17 22:50:42 | |
Balcanocerus larvatus (Herrich-Schäffer, 1835) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Auchenorrhyncha, Cicadomorpha, Cicadellidae, Balcanocerus, Balcanocerus larvatus (Herrich-Schäffer, 1835) | 100.0000 | 0E-8 | 2023-09-01 09:07:40 |
Balcanocerus larvatus | BOLD | Arthropoda, Insecta, Hemiptera, Cicadellidae, Eurymelinae, Balcanocerus, Balcanocerus larvatus | 100.0000 | 2023-09-01 09:07:40 |
Occurrences |
Total of 745 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 745 occurrences in 69 samples: ASV table 40 version 2 Download Total of 527 occurrences in 30 samples: ASV table 42 version 1 Download Total of 527 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 527 occurrences in 30 samples: ASV table 42 version 3 Download Total of 527 occurrences in 30 samples: ASV table 42 version 4 Download Total of 745 occurrences in 69 samples: ASV table 40 version 3 Download |