ASV Sequence GBOL_ASV_ID_80537
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1198 |
| Primers | fwhF2, Fol-degen-rev |
CTTATCACTAAATTCAAGACATGAGGGAATATCTGTAGATTTATCAATTTTTTCTCTTCATTTAGCAGGTATATCTTCAATCATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGATGTTTAGGAACATCCTTAGATCAAATATCTTTATTTACTTGATCAATAAAAATTACAACAATTTTATTATTATTAGCAGTTCCAGTTCTTGCAGGAGCAATCACTATATTATTAGCAGATCGAAACTTAAATACTTCTTTTTTTGACCCTTCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT
Currently, no taxa have been assigned
| Occurrences |
Total of 664 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 664 occurrences in 69 samples: ASV table 40 version 2 Download Total of 446 occurrences in 30 samples: ASV table 42 version 1 Download Total of 446 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 446 occurrences in 30 samples: ASV table 42 version 3 Download Total of 446 occurrences in 30 samples: ASV table 42 version 4 Download Total of 664 occurrences in 69 samples: ASV table 40 version 3 Download |