ASV Sequence GBOL_ASV_ID_80526
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_239 Project: AMMOD I with original sequence id: 281b6b6d8e38a6ec6499ad204cf798e2 Project: NaPA with original sequence id: uniq1941;size=527 |
| Primers | fwhF2, Fol-degen-rev |
TCTATCTTCTAACATTGCTCACGGAGGAGCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATCTCATCTATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCTACTGGAATTACATTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGCTTTATTATTACTTTTATCATTGCCTGTACTAGCAGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATACCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Fannia | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Fanniidae, Fannia | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Fannia serena (Fallén, 1825) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Fanniidae, Fannia, Fannia serena (Fallén, 1825) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Fannia similis (Stein, 1895) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Fanniidae, Fannia, Fannia similis (Stein, 1895) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Fannia serena Fallen, 1825 | BOLD | Arthropoda, Insecta, Diptera, Fanniidae, Fannia, Fannia serena Fallen, 1825 | 100.0000 | 2022-10-17 22:50:42 | |
| Fannia aff. subsimilis | BOLD | Arthropoda, Insecta, Diptera, Fanniidae, Fannia, Fannia aff. subsimilis | 100.0000 | 2022-10-17 22:50:42 | |
| Fannia aff. subsimilis | BOLD | Arthropoda, Insecta, Diptera, Fanniidae, Fannia, Fannia aff. subsimilis | 100.0000 | 2023-09-01 09:07:40 | |
| Fannia | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Fanniidae, Fannia | 100.0000 | 0E-8 | 2025-01-15 14:08:50 |
| Occurrences |
Total of 6825 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 6825 occurrences in 69 samples: ASV table 40 version 2 Download Total of 6534 occurrences in 30 samples: ASV table 42 version 1 Download Total of 6534 occurrences in 30 samples: ASV table 42 version 2 Download Total of 1 occurrences in 30 samples: ASV table 44 version 1 Download Total of 1 occurrences in 30 samples: ASV table 44 version 2 Download Total of 6534 occurrences in 30 samples: ASV table 42 version 3 Download Total of 6534 occurrences in 30 samples: ASV table 42 version 4 Download Total of 18684 occurrences in 5 samples: ASV table 115 version 1 Download Total of 6825 occurrences in 69 samples: ASV table 40 version 3 Download |