ASV Sequence GBOL_ASV_ID_80519
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_488 Project: AMMOD I with original sequence id: 2db46980b42c8f44eb7eee93b9057267 |
| Primers | fwhF2, Fol-degen-rev |
CTTAGCAAGAAATATTGCTCACTCAGGGGTTAGAGTTGATTTAACAATTTTTTCACTACATATAGCAGGGGTTTCATCAATTTTAGGAGCTGTAAATTTCATTACAACAGTAATTAATATACGAACAAGATTAATAACACTTGATTCAACACCATTGTTTGTGTGGTCAGTGTTTATTACTGCTATTTTACTTTTACTATCATTACCAGTTTTAGCTGGAGCAATCACAATATTATTAACAGACCGGAACATTAACACATCATTTTTCGACCCTTCTGGAGGGGGAGACCCAATTCTGTATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Eupteryx aurata (Linnaeus, 1758) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Auchenorrhyncha, Cicadomorpha, Cicadellidae, Eupteryx, Eupteryx aurata (Linnaeus, 1758) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Eupteryx aurata Linnaeus, 1758 | BOLD | Arthropoda, Insecta, Hemiptera, Cicadellidae, Typhlocybinae, Eupteryx, Eupteryx aurata Linnaeus, 1758 | 100.0000 | 2022-10-17 22:50:42 | |
| Eupteryx aurata Linnaeus, 1758 | BOLD | Arthropoda, Insecta, Hemiptera, Cicadellidae, Typhlocybinae, Eupteryx, Eupteryx aurata Linnaeus, 1758 | 100.0000 | 2023-09-01 09:07:40 | |
| Eupteryx aurata (Linnaeus, 1758) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Auchenorrhyncha, Cicadomorpha, Cicadellidae, Eupteryx, Eupteryx aurata (Linnaeus, 1758) | 100.0000 | 0E-8 | 2025-01-15 14:08:50 |
| Occurrences |
Total of 2723 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 2723 occurrences in 69 samples: ASV table 40 version 2 Download Total of 2500 occurrences in 30 samples: ASV table 42 version 1 Download Total of 2500 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 2500 occurrences in 30 samples: ASV table 42 version 3 Download Total of 2500 occurrences in 30 samples: ASV table 42 version 4 Download Total of 57398 occurrences in 5 samples: ASV table 115 version 1 Download Total of 2723 occurrences in 69 samples: ASV table 40 version 3 Download |