ASV Sequence GBOL_ASV_ID_80509
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1231 Project: AMMOD I with original sequence id: c2489699c2f7b42ec82838e3e262caa4 |
| Primers | fwhF2, Fol-degen-rev |
TCTATCATCAACAATTGCCCACGGAGGAGCATCAGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGAGTATCATCTATTTTAGGAGCTGTTAATTTTATTACTACAGTAATTAATATACGATCAATTGGAATTACTTTTGATCGAATACCTTTATTTGTTTGATCTGTAGTTATTACAGCTCTTCTATTACTTTTATCTTTACCAGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCCGGAGGAGGAGATCCAATTCTTTACCAACATTTATTC
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Chalarus spurius (Fallén, 1816) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Pipunculidae, Chalarus, Chalarus spurius (Fallén, 1816) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
| Chalarus spurius Fallen, 1816 | BOLD | Arthropoda, Insecta, Diptera, Pipunculidae, Chalarinae, Chalarus, Chalarus spurius Fallen, 1816 | 100.0000 | 2022-10-17 22:50:42 | |
| Chalarus spurius Fallen, 1816 | BOLD | Arthropoda, Insecta, Diptera, Pipunculidae, Chalarinae, Chalarus, Chalarus spurius Fallen, 1816 | 99.0000 | 2022-10-17 22:50:42 | |
| Chalarus spurius (Fallén, 1816) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Pipunculidae, Chalarus, Chalarus spurius (Fallén, 1816) | 100.0000 | 0E-8 | 2023-09-01 09:07:40 |
| Chalarus spurius Fallen, 1816 | BOLD | Arthropoda, Insecta, Diptera, Pipunculidae, Chalarinae, Chalarus, Chalarus spurius Fallen, 1816 | 100.0000 | 2023-09-01 09:07:40 |
| Occurrences |
Total of 614 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 614 occurrences in 69 samples: ASV table 40 version 2 Download Total of 623 occurrences in 30 samples: ASV table 42 version 1 Download Total of 623 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 623 occurrences in 30 samples: ASV table 42 version 3 Download Total of 623 occurrences in 30 samples: ASV table 42 version 4 Download Total of 347 occurrences in 5 samples: ASV table 115 version 1 Download Total of 614 occurrences in 69 samples: ASV table 40 version 3 Download |