ASV Sequence GBOL_ASV_ID_80465
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1691 |
| Primers | fwhF2, Fol-degen-rev |
TCTCTCATCTATTATTGCTCACGCTGGGACTTCAGTAGATTTATCAATTTTTTCATTACATATAGCGGGAATCTCATCCATCTTAGGGGCAATTAATTTTATTACTACTATACTTAATATGCGAATTAAAAATGTTCATTTTAGACAAATTTCTCTATTTTCATGATCCGTAGTAATTACTGCTGTCTTATTACTACTTTCACTACCTGTATTAGCAGGAGCTATTACAATACTTTTAACAGACCGAAATTTAAACACTTCATTTTTTGATCCCTCCGGCGGAGGAGATCCAATTTTGTACCAACACTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Cecidomyiidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Cecidomyiidae | 100.0000 | 0E-8 | 2024-04-29 12:57:03 |
| Divellepidosis armilla | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Cecidomyiidae, Porricondylinae, Divellepidosis, Divellepidosis armilla | 100.0000 | 0E-8 | 2025-12-04 21:49:01 |
| Cecidomyiidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Cecidomyiidae | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 299 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 299 occurrences in 69 samples: ASV table 40 version 2 Download Total of 244 occurrences in 30 samples: ASV table 42 version 1 Download Total of 244 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 244 occurrences in 30 samples: ASV table 42 version 3 Download Total of 244 occurrences in 30 samples: ASV table 42 version 4 Download Total of 299 occurrences in 69 samples: ASV table 40 version 3 Download |