ASV Sequence GBOL_ASV_ID_80457
Date added | 2022-10-17 19:50:00 |
Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1972 |
Primers | fwhF2, Fol-degen-rev |
TTTATCTGCAAATATTGCTCATTCGGGAGCCAGAGTTGATTTAGCTATTTTTTCTTTACACCTAGCTGGTATTTCATCAATTTTAGGAGCAGTAAATTTTATTACTACAGTTATTAATATACGATCTAGAAAGATAACACTTGATCGAATTCCTTTATTTGTTTGATCAGTTGTAATTACAGCAGTATTATTACTATTATCATTACCTGTATTAGCAGGCGCAATTACCATACTTTTGACTGACCGAAATTTAAATACTTCATTTTTTGACCCTTCTGGAGGGGGGGACCCTATTTTATACCAACACTTATTT
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Cicadellidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Auchenorrhyncha, Cicadomorpha, Cicadellidae | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
Zygina schneideri (Günthart, 1974) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Auchenorrhyncha, Cicadomorpha, Cicadellidae, Zygina, Zygina schneideri (Günthart, 1974) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
Zygina ordinaria | BOLD | Arthropoda, Insecta, Hemiptera, Cicadellidae, Typhlocybinae, Zygina, Zygina ordinaria | 98.0000 | 2022-10-17 22:50:42 | |
Zygina ordinaria | BOLD | Arthropoda, Insecta, Hemiptera, Cicadellidae, Typhlocybinae, Zygina, Zygina ordinaria | 98.0000 | 2023-09-01 09:07:40 | |
Cicadellidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Auchenorrhyncha, Cicadomorpha, Cicadellidae | 100.0000 | 0E-8 | 2024-04-29 12:57:03 |
Occurrences |
Total of 174 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 174 occurrences in 69 samples: ASV table 40 version 2 Download Total of 39 occurrences in 30 samples: ASV table 42 version 1 Download Total of 39 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 39 occurrences in 30 samples: ASV table 42 version 3 Download Total of 39 occurrences in 30 samples: ASV table 42 version 4 Download Total of 174 occurrences in 69 samples: ASV table 40 version 3 Download |