ASV Sequence GBOL_ASV_ID_80446
Date added | 2022-10-17 19:50:00 |
Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1914 Project: AMMOD I with original sequence id: 8891198a15db1b30b133423e503c49b6 |
Primers | fwhF2, Fol-degen-rev |
ACTTTCATCTAATATTGCCCATGGAGGAAGATCAGTTGATTTAGCAATTTTTTCCCTCCATTTAGCCGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATAAAACCTAATAATATAACACTTGACCAAATACCCCTTTTTGTTTGATCAGTACAAATTACAGCAATTTTATTATTATTATCACTTCCTGTATTAGCAGGAGCTATTACAATACTTTTAACAGATCGTAATTTAAATACATCCTTTTTTGATCCTGCTGGGGGGGGAGATCCTATTCTTTACCAACACTTATTC
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Anthophila fabriciana (Linnaeus, 1767) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Lepidoptera, Choreutoidea, Choreutidae, Choreutinae, Anthophila, Anthophila, Anthophila fabriciana (Linnaeus, 1767) | 100.0000 | 0E-8 | 2022-10-17 22:50:42 |
Anthophila fabriciana Linnaeus, 1767 | BOLD | Arthropoda, Insecta, Lepidoptera, Choreutidae, Choreutinae, Anthophila, Anthophila fabriciana Linnaeus, 1767 | 100.0000 | 2022-10-17 22:50:42 | |
Anthophila fabriciana (Linnaeus, 1767) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Lepidoptera, Choreutoidea, Choreutidae, Choreutinae, Anthophila, Anthophila, Anthophila fabriciana (Linnaeus, 1767) | 100.0000 | 0E-8 | 2023-09-01 09:07:40 |
Anthophila fabriciania | BOLD | Arthropoda, Insecta, Lepidoptera, Choreutidae, Choreutinae, Anthophila, Anthophila fabriciania | 100.0000 | 2023-09-01 09:07:40 |
Occurrences |
Total of 253 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 253 occurrences in 69 samples: ASV table 40 version 2 Download Total of 156 occurrences in 30 samples: ASV table 42 version 1 Download Total of 156 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 156 occurrences in 30 samples: ASV table 42 version 3 Download Total of 156 occurrences in 30 samples: ASV table 42 version 4 Download Total of 1486 occurrences in 5 samples: ASV table 115 version 1 Download Total of 253 occurrences in 69 samples: ASV table 40 version 3 Download |