ASV Sequence GBOL_ASV_ID_80440
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1804 |
| Primers |
fwhF2, Fol-degen-rev |
CCTTTCTTCAATTATTGCTCACACAGGATCCTCAGTAGATTTTTCAATTTTTTCATTACATATTGCTGGAATTTCATCAATTTTAGGAGCGATTAATTTTATTTCCACTATAATAAATATAAAAATTAATTTTTTAAAATTTGACCAAATTTCTTTATTTATCTGATCAATTTTAATTACTACTATTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAACACTTCATTTTTTGATCCTATAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| CecidInt9 sp. BOLD:AAP6851 | BOLD | Arthropoda, Insecta, Diptera, Cecidomyiidae, CecidInt9 sp. BOLD:AAP6851 | 100.0000 | 2022-10-17 22:50:42 | |
| Cecidomyiidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Cecidomyiidae | 100.0000 | 0E-8 | 2024-04-29 12:57:03 |
| Cecidomyiidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Cecidomyiidae | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 289 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 289 occurrences in 69 samples: ASV table 40 version 2 Download Total of 60 occurrences in 30 samples: ASV table 42 version 1 Download Total of 60 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 60 occurrences in 30 samples: ASV table 42 version 3 Download Total of 60 occurrences in 30 samples: ASV table 42 version 4 Download Total of 289 occurrences in 69 samples: ASV table 40 version 3 Download |