ASV Sequence GBOL_ASV_ID_80415
| Date added | 2022-10-17 19:50:00 |
| Provided in projects: |
Project: Pooling Malaise trap fractions with original sequence id: OTU_1047 |
| Primers | fwhF2, Fol-degen-rev |
GCTATCTTCAACTATCTCACACTCAGGGGCTTCCGTAGATCTATCTATTTTTTCACTCCATCTAGCCGGGATTTCATCAATTTTAGGGGCCGTAAACTTTATTTCAACTATTATTAATATACGGGCGCCAGGAATATCATTTGATAAAATACCTTTATTTGTGTGATCTGTATTAATTACAGCAATTTTACTTCTTCTATCCCTCCCAGTACTAGCAGGAGCTATTACTATGTTATTAACAGACCGAAATTTAAATACCTCATTTTTCGACCCGGCTGGTGGCGGGGATCCAATTTTATACCAACATCTATTC
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Sciaridae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae | 100.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Sciaridae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae | 100.0000 | 0E-8 | 2025-01-15 14:08:50 |
| Occurrences |
Total of 750 occurrences in 69 samples:
ASV table 40 version 1 Download
Total of 750 occurrences in 69 samples: ASV table 40 version 2 Download Total of 461 occurrences in 30 samples: ASV table 42 version 1 Download Total of 461 occurrences in 30 samples: ASV table 42 version 2 Download Total of 0 occurrences in 30 samples: ASV table 44 version 1 Download Total of 0 occurrences in 30 samples: ASV table 44 version 2 Download Total of 461 occurrences in 30 samples: ASV table 42 version 3 Download Total of 461 occurrences in 30 samples: ASV table 42 version 4 Download Total of 750 occurrences in 69 samples: ASV table 40 version 3 Download |