ASV Sequence GBOL_ASV_ID_9241
Date added | 2022-08-01 13:21:24 |
Provided in projects: |
Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_5599 Project: Sandras Testprojekt with original sequence id: 8680d4cbbbacdc70e6ae2cb958c93f3f |
Primers |
CCTTTCCAACGCAATTGCCCACGCTGGGAGATCAGTCGACCTATCCATCTTTTCCTTACATTTAGCTGGCGTATCCTCAATCCTAGGCGCCGTAAATTTCATTACAACAGTAATTAATATACGAATACCAGGAATAACAATAGAACGTGTACCTCTATTTGTTTGGTCTGTTCTAATTACAGCCATTTTACTATTATTGTCCCTTCCAGTTCTAGCAGGAGCCATTACAATACTCCTAACAGACCGTAATCTAAACACCTCTTTTTTTGACCCAACAGGGGGGGGAGACCCCATCCTATATCAACATCTCTTC
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Ctenolepisma longicaudata | BOLD | Arthropoda, Insecta, Zygentoma, Lepismatidae, Ctenolepismatinae, Ctenolepisma, Ctenolepisma longicaudata | 99.0000 | 2022-11-09 13:35:02 | |
Ctenolepisma longicaudatum Escherich, 1905 | BOLD | Arthropoda, Insecta, Zygentoma, Lepismatidae, Ctenolepismatinae, Ctenolepisma, Ctenolepisma longicaudatum Escherich, 1905 | 99.0000 | 2023-05-17 16:56:05 | |
Ctenolepisma | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Zygentoma, Lepismatidae, Ctenolepisma | 99.0000 | 0E-8 | 2025-01-15 14:08:50 |
Occurrences |
Total of 9 occurrences in 61 samples:
ASV table 78 version 1 Download
Total of 9 occurrences in 61 samples: ASV table 78 version 2 Download Total of 9 occurrences in 61 samples: ASV table 78 version 3 Download Total of 98 occurrences in 152 samples: ASV table 116 version 1 Download Total of 98 occurrences in 152 samples: ASV table 116 version 2 Download |