ASV Sequence GBOL_ASV_ID_9241

Date added 2022-08-01 13:21:24
Provided in projects: Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_5599
Project: Sandras Testprojekt with original sequence id: 8680d4cbbbacdc70e6ae2cb958c93f3f
Primers

CCTTTCCAACGCAATTGCCCACGCTGGGAGATCAGTCGACCTATCCATCTTTTCCTTACATTTAGCTGGCGTATCCTCAATCCTAGGCGCCGTAAATTTCATTACAACAGTAATTAATATACGAATACCAGGAATAACAATAGAACGTGTACCTCTATTTGTTTGGTCTGTTCTAATTACAGCCATTTTACTATTATTGTCCCTTCCAGTTCTAGCAGGAGCCATTACAATACTCCTAACAGACCGTAATCTAAACACCTCTTTTTTTGACCCAACAGGGGGGGGAGACCCCATCCTATATCAACATCTCTTC

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Ctenolepisma longicaudata BOLD Arthropoda, Insecta, Zygentoma, Lepismatidae, Ctenolepismatinae, Ctenolepisma, Ctenolepisma longicaudata 99.0000 2022-11-09 13:35:02
Ctenolepisma longicaudatum Escherich, 1905 BOLD Arthropoda, Insecta, Zygentoma, Lepismatidae, Ctenolepismatinae, Ctenolepisma, Ctenolepisma longicaudatum Escherich, 1905 99.0000 2023-05-17 16:56:05
Ctenolepisma GBOL Animalia, Arthropoda, Hexapoda, Insecta, Zygentoma, Lepismatidae, Ctenolepisma 99.0000 0E-8 2025-01-15 14:08:50

Occurrences Total of 9 occurrences in 61 samples: ASV table 78 version 1 Download
Total of 9 occurrences in 61 samples: ASV table 78 version 2 Download
Total of 9 occurrences in 61 samples: ASV table 78 version 3 Download
Total of 98 occurrences in 152 samples: ASV table 116 version 1 Download
Total of 98 occurrences in 152 samples: ASV table 116 version 2 Download