ASV Sequence GBOL_ASV_ID_77737
| Date added | 2022-09-30 11:16:47 |
| Provided in projects: |
Project: Publication Zizka et al. 2018 with original sequence id: OTU_282 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_282 Project: Improved freshwater macroinvertebrate detection with original sequence id: OTU_176 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_576 |
| Primers | BF2, BR2 |
TAGACTTAATAATATAAGTTTCTGATTATTACCACCTAGTTTATTATTATTTTTATTTGCTAGTGGTATAGAAAATGGGGTAGGTACTGGTTGAACTCTTTACCCACCTTTAAGTGGAATTCAAAGTCACAGTGGACCTAGTGTAGATTTAGCAATATTTGGATTACATCTATCAGGTATAAGTAGTTTATTAGGTGCTATAAACTTTATAACTACTATACTTAACATGAGAAGTCCGGGTATAAGATTACACAAATTAGCTTTATTTGGATGAGCTGTAGTAGTTACAGCCGTGTTATTATTATTATCTTTACCTGTACTTGCAGGAGGAATTACAATGGTTTTAACTGATAGAAATTTTAATACATCATTCTTTGAAGCTGCAGGAGGTGGTGATCCTATACTTTACCAACATCTTTTC
Currently, no taxa have been assigned
| Occurrences |
Total of 498 occurrences in 29 samples:
ASV table 34 version 1 Download
Total of 498 occurrences in 29 samples: ASV table 34 version 2 Download Total of 498 occurrences in 29 samples: ASV table 34 version 3 Download Total of 498 occurrences in 29 samples: ASV table 34 version 4 Download Total of 498 occurrences in 29 samples: ASV table 57 version 1 Download Total of 498 occurrences in 29 samples: ASV table 57 version 2 Download Total of 3230 occurrences in 213 samples: ASV table 59 version 1 Download Total of 3230 occurrences in 213 samples: ASV table 59 version 2 Download Total of 3230 occurrences in 213 samples: ASV table 59 version 3 Download Total of 498 occurrences in 29 samples: ASV table 57 version 3 Download Total of 173 occurrences in 12 samples: ASV table 120 version 1 Download |