ASV Sequence GBOL_ASV_ID_77576
Date added | 2022-09-30 11:16:47 |
Provided in projects: |
Project: Publication Zizka et al. 2018 with original sequence id: OTU_326 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_326 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_208 |
Primers | BF2, BR2 |
TCGTATAAATAATATAAGTTTTTGACTTTTACCCCCCTCTCTTACTTTACTTCTTTCTAGTTCAATTGTAGAAAACGGAGCTGGAACAGGATGAACTGTATATCCCCCTCTATCTTCTAGTATTGCTCATAGAGGAGCTTCCGTTGATCTAGCTATTTTTTCACTACATTTAGCAGGAGTTTCTTCTATTTTAGGTTCTGTAAATTTTATTACAACTGTAATTAATATACGTTCTAATGGTATTACACTTGATCGAATACCCTTATTTGTATGATCAATTGTAATTACAACTGTTCTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACCATACTTTTAACAGATCGAAATCTTAATACTTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Polypedilum albicorne (Meigen, 1838) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Polypedilum, Polypedilum, Polypedilum albicorne (Meigen, 1838) | 100.0000 | 0E-8 | 2022-09-30 11:22:47 |
Polypedilum albicorne Meigen, 1838 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Chironominae, Polypedilum, Polypedilum albicorne Meigen, 1838 | 100.0000 | 2022-09-30 11:22:47 | |
Polypedilum albicorne (Meigen, 1838) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Polypedilum, Polypedilum, Polypedilum albicorne (Meigen, 1838) | 100.0000 | 0E-8 | 2024-01-15 09:13:42 |
Occurrences |
Total of 566 occurrences in 29 samples:
ASV table 34 version 1 Download
Total of 566 occurrences in 29 samples: ASV table 34 version 2 Download Total of 566 occurrences in 29 samples: ASV table 34 version 3 Download Total of 566 occurrences in 29 samples: ASV table 34 version 4 Download Total of 566 occurrences in 29 samples: ASV table 57 version 1 Download Total of 566 occurrences in 29 samples: ASV table 57 version 2 Download Total of 566 occurrences in 29 samples: ASV table 57 version 3 Download Total of 2044 occurrences in 12 samples: ASV table 120 version 1 Download |