ASV Sequence GBOL_ASV_ID_77134
| Date added | 2022-09-30 11:16:47 |
| Provided in projects: |
Project: Publication Zizka et al. 2018 with original sequence id: OTU_150 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_150 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_97 |
| Primers | BF2, BR2 |
TCGAATAAATAATATAAGTTTCTGGATATTACCCCCCTCATTAACTTTATTATTATCAAGATCAATTGTAGAAAACGGAGCGGGAACAGGTTGAACAGTTTATCCCCCTCTTTCCTCAGGAATTGCTCATACTGGGGCATCAGTAGATCTAGCTATTTTTTCACTTCATTTAGCTGGTATTTCATCAATTTTAGGGGCTGTTAATTTTATTACCACTATTATTAATATACGTTCAAGAGGAATTTCATTAGACCGCATGCCATTATTTGTTTGATCAGTACTAATTACTGCTATTTTACTTTTGCTTTCATTGCCAGTTTTAGCTGGGGCTATTACAATATTATTAACAGATCGTAACTTAAATACCTCATTTTTTGACCCTGCTGGAGGAGGAGACCCTATTTTATACCAACATCTTTTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Nilotanypus dubius (Meigen, 1804) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Nilotanypus, Nilotanypus dubius (Meigen, 1804) | 100.0000 | 0E-8 | 2022-09-30 11:22:47 |
| Nilotanypus dubius (Meigen, 1804) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Nilotanypus, Nilotanypus dubius (Meigen, 1804) | 100.0000 | 0E-8 | 2025-07-31 20:35:36 |
| Occurrences |
Total of 1088 occurrences in 29 samples:
ASV table 34 version 1 Download
Total of 1088 occurrences in 29 samples: ASV table 34 version 2 Download Total of 1088 occurrences in 29 samples: ASV table 34 version 3 Download Total of 1088 occurrences in 29 samples: ASV table 34 version 4 Download Total of 1088 occurrences in 29 samples: ASV table 57 version 1 Download Total of 1088 occurrences in 29 samples: ASV table 57 version 2 Download Total of 1088 occurrences in 29 samples: ASV table 57 version 3 Download Total of 5580 occurrences in 12 samples: ASV table 120 version 1 Download |