ASV Sequence GBOL_ASV_ID_76792
Date added | 2022-09-30 11:16:47 |
Provided in projects: |
Project: Publication Zizka et al. 2018 with original sequence id: OTU_2569 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_2569 Project: Improved freshwater macroinvertebrate detection with original sequence id: OTU_2674 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_618 |
Primers | BF2, BR2 |
ACGATTAAATAACCTTAGATTTTGATTACTACCACCTTCACTAATTCTATTAGTATCATCTGCCGCTGTAGAAAAAGGAGCCGGAACAGGATGAACTGTATATCCACCATTATCAAGAAACTTAGCACATGCAGGACCATCAGTTGACATGGCTATTTTCTCATTACACTTAGCAGGTGCATCATCTATTTTAGGTGCAGTAAACTTTATTACAACAGTAATAAATATACGATGAAATGGAATACGACTAGAACGAGTCCCATTATTTGTATGAGCAGTTCTACTTACTGTAATTCTACTTCTACTATCATTACCAGTACTTGCAGGAGCAATTACAATACTACTAACAGATCGAAATCTAAATACTTCATTCTTCGATCCAGCAGGAGGAGGAGATCCAATTCTATACCAACATTTATTT
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Nais communis Piguet, 1906 | BOLD | Annelida, Clitellata, Haplotaxida, Naididae, Naidinae, Nais, Nais communis Piguet, 1906 | 99.0000 | 2022-09-30 11:22:47 | |
Nais communis Piguet, 1906 | BOLD | Annelida, Clitellata, Haplotaxida, Naididae, Naidinae, Nais, Nais communis Piguet, 1906 | 100.0000 | 2022-09-30 11:22:47 |
Occurrences |
Total of 56 occurrences in 29 samples:
ASV table 34 version 1 Download
Total of 56 occurrences in 29 samples: ASV table 34 version 2 Download Total of 56 occurrences in 29 samples: ASV table 34 version 3 Download Total of 56 occurrences in 29 samples: ASV table 34 version 4 Download Total of 56 occurrences in 29 samples: ASV table 57 version 1 Download Total of 56 occurrences in 29 samples: ASV table 57 version 2 Download Total of 215 occurrences in 213 samples: ASV table 59 version 1 Download Total of 215 occurrences in 213 samples: ASV table 59 version 2 Download Total of 215 occurrences in 213 samples: ASV table 59 version 3 Download Total of 56 occurrences in 29 samples: ASV table 57 version 3 Download Total of 399 occurrences in 12 samples: ASV table 120 version 1 Download |