ASV Sequence GBOL_ASV_ID_75855
| Date added | 2022-09-30 11:16:47 |
| Provided in projects: |
Project: Publication Zizka et al. 2018 with original sequence id: OTU_3063 Project: DNA metabarcoding from sample fixative with original sequence id: OTU_3063 |
| Primers | BF2, BR2 |
GCGCATAAATAACATAAGATTCTGATTATTACCCCCTACTTCTAATAAGAAGTTTAGTAGAAAGGGGGGTGGGCACGGGTTGAACTGTCTACCCCCCCTTAGCCGGCAACTCCGCACATAGCGGAAGCGCTGTAGATTTAGCTATTTTCTCTTTACACCTAGCGGGGGCTTCTTCCATTTTAGGTGCCATCAACTTTATTTCCACCGTCCTAAATATACGCAGACCCGGCATATCCATAGACCAGGCGCCTCTCTTTGTCTGGTCTATTTTTATTACCACTATCCTACTTCTATTATCTCTGCCAGTTCTTGCTGGAGCCATTACTATATTACTGACAGACCGTAATCTAAATACCTCTTTTTTTGATCCTTGCGGCGGGGGGGATCCAATTTTATACCAGCACTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Gammarus fossarum | BOLD | Arthropoda, Malacostraca, Amphipoda, Gammaridae, Gammarus, Gammarus fossarum | 99.0000 | 2022-09-30 11:22:47 | |
| Dugesia gonocephala (Duges, 1830) | GBOL | Animalia, Platyhelminthes, Rhabditophora, Tricladida, Dugesiidae, Dugesia, Dugesia gonocephala (Duges, 1830) | 99.0000 | 0E-8 | 2025-07-31 20:35:36 |
| Occurrences |
Total of 295 occurrences in 29 samples:
ASV table 34 version 1 Download
Total of 295 occurrences in 29 samples: ASV table 34 version 2 Download Total of 295 occurrences in 29 samples: ASV table 34 version 3 Download Total of 295 occurrences in 29 samples: ASV table 34 version 4 Download Total of 295 occurrences in 29 samples: ASV table 57 version 1 Download Total of 295 occurrences in 29 samples: ASV table 57 version 2 Download Total of 295 occurrences in 29 samples: ASV table 57 version 3 Download |