ASV Sequence GBOL_ASV_ID_6703
Date added | 2022-08-01 13:21:24 |
Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_2559 Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_7291 Project: Sandras Testprojekt with original sequence id: 2df2659d2ff2059d7bd60ecf99284754 Project: Test 20250115 with original sequence id: OTU_2559 Project: DINA_BN with original sequence id: OTU_972 |
Primers |
TTTATCTTCTACCTTATCCCATTCAGGGGCCTCTGTAGATTTATCTATTTTTTCACTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCAGTAAATTTTATTTCTACTATTATTAATATACGAACTCCTGGTATACTTTTTGATAAAATACCCTTATTTGTATGATCAGTTTTTATTACAGCTATTTTATTATTATTATCTCTACCTGTATTAGCAGGAGCTATTACAATACTATTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCAGCAGGGGGAGGAGACCCAATTCTATATCAACATTTATTT
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Cratyna nobilis Winnertz, 1867 | BOLD | Arthropoda, Insecta, Diptera, Sciaridae, Cratyna, Cratyna nobilis Winnertz, 1867 | 100.0000 | 2023-05-17 16:56:05 | |
Cratyna nobilis | NCBI Arthropoda COI | Cratyna nobilis, Cratyna, Sciaridae, Nematocera, Diptera, Pterygota, Insecta, Hexapoda, Arthropoda | 100.0000 | 2024-05-06 10:18:11 | |
Cratyna nobilis (Winnertz, 1867) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae, Cratyna, Spathobdella, Cratyna nobilis (Winnertz, 1867) | 100.0000 | 0E-8 | 2025-01-15 14:08:50 |
Occurrences |
Total of 150 occurrences in 69 samples:
ASV table 4 version 1 Download
Total of 5 occurrences in 61 samples: ASV table 78 version 1 Download Total of 5 occurrences in 61 samples: ASV table 78 version 2 Download Total of 5 occurrences in 61 samples: ASV table 78 version 3 Download Total of 14 occurrences in 152 samples: ASV table 116 version 1 Download Total of 14 occurrences in 152 samples: ASV table 116 version 2 Download Total of 150 occurrences in 60 samples: ASV table 153 version 1 Download Total of 74 occurrences in 1248 samples: ASV table 155 version 1 Download |