ASV Sequence GBOL_ASV_ID_6703

Date added 2022-08-01 13:21:24
Provided in projects: Project: Björns Testprojekt with original sequence id: OTU_2559
Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_7291
Project: Sandras Testprojekt with original sequence id: 2df2659d2ff2059d7bd60ecf99284754
Project: Test 20250115 with original sequence id: OTU_2559
Project: DINA_BN with original sequence id: OTU_972
Primers

TTTATCTTCTACCTTATCCCATTCAGGGGCCTCTGTAGATTTATCTATTTTTTCACTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCAGTAAATTTTATTTCTACTATTATTAATATACGAACTCCTGGTATACTTTTTGATAAAATACCCTTATTTGTATGATCAGTTTTTATTACAGCTATTTTATTATTATTATCTCTACCTGTATTAGCAGGAGCTATTACAATACTATTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCAGCAGGGGGAGGAGACCCAATTCTATATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Cratyna nobilis Winnertz, 1867 BOLD Arthropoda, Insecta, Diptera, Sciaridae, Cratyna, Cratyna nobilis Winnertz, 1867 100.0000 2023-05-17 16:56:05
Cratyna nobilis NCBI Arthropoda COI Cratyna nobilis, Cratyna, Sciaridae, Nematocera, Diptera, Pterygota, Insecta, Hexapoda, Arthropoda 100.0000 2024-05-06 10:18:11
Cratyna nobilis (Winnertz, 1867) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae, Cratyna, Spathobdella, Cratyna nobilis (Winnertz, 1867) 100.0000 0E-8 2025-01-15 14:08:50

Occurrences Total of 150 occurrences in 69 samples: ASV table 4 version 1 Download
Total of 5 occurrences in 61 samples: ASV table 78 version 1 Download
Total of 5 occurrences in 61 samples: ASV table 78 version 2 Download
Total of 5 occurrences in 61 samples: ASV table 78 version 3 Download
Total of 14 occurrences in 152 samples: ASV table 116 version 1 Download
Total of 14 occurrences in 152 samples: ASV table 116 version 2 Download
Total of 150 occurrences in 60 samples: ASV table 153 version 1 Download
Total of 74 occurrences in 1248 samples: ASV table 155 version 1 Download