ASV Sequence GBOL_ASV_ID_66856

Date added 2022-08-12 14:45:18
Provided in projects: Project: Björns Testprojekt with original sequence id: OTU_169
 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66856
 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_169
Primers 

							

						

					


					


					



						

							

								
							


							

								

									

											CCCTCTTTCTTCTAATATTGCCCATACCGGAGCATCGGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGTATTTCCTCGATTTTAGGAGCCGTAAATTTTATTACCACAGTAATTAATATACGATCTGAAGGAATTACTTTAGACCGAATACCTTTATTTGTTTGATCAGTAGTTATTACAGCAGTGCTTCTTCTTTTATCTCTACCTGTTTTA
									

								

							

						



						

							

								
							


							

								

									

										
										

											
											

												Taxon
												Reference database
												Taxonomy
												Identity [%]
												evalue
												Date of assignment
											

											
											
											

												
													Brillia flavifrons Johannsen, 1905
									
												
												
									
										BOLD
									
													
												
												
									
										Arthropoda, Insecta, Diptera, Chironomidae, Orthocladiinae, Brillia, Brillia flavifrons Johannsen, 1905
									
												
												
													98.0000
												
												
													
												
												
													2022-10-20 00:49:26
												
											

											
										

									

								

							

						



						

							

								
							


							

								

                                    

										

											

												Occurrences
												
								Total of 62198 occurrences in 144 samples:
								ASV table 11 version 1 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 11 version 2 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 11 version 3 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 48 version 1 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 48 version 2 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 48 version 3 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 48 version 4 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 48 version 5 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 48 version 6 Download
								

        Total of 62198 occurrences in 144 samples:
								ASV table 121 version 1 Download