ASV Sequence GBOL_ASV_ID_66855
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_152 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66855 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_152 |
| Primers |
TCCTTTATCTTCTGGAATTGCTCACGCCGGAGCCTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCTTCTATTTTAGGGGCAGTAAATTTTATCACAACAGTAATTAATATACGTTCTTCTGGAATTACATTAGACCGAATACCTTTATTTGTTTGATCAGTTGTAATCACGGCTATTTTACTTTTATTGTCTTTACCAGTTTTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Potthastia gaedii Meigen, 1838 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Diamesinae, Potthastia, Potthastia gaedii Meigen, 1838 | 99.0000 | 2022-10-20 00:49:26 | |
| Potthastia gaedii Meigen, 1838 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Diamesinae, Potthastia, Potthastia gaedii Meigen, 1838 | 100.0000 | 2022-10-20 00:49:26 | |
| Rheocricotopus sp. BAP32 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Orthocladiinae, Rheocricotopus, Rheocricotopus sp. BAP32 | 99.0000 | 2022-10-20 00:49:26 |
| Occurrences |
Total of 43231 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 43231 occurrences in 144 samples: ASV table 11 version 2 Download Total of 43231 occurrences in 144 samples: ASV table 11 version 3 Download Total of 43231 occurrences in 144 samples: ASV table 48 version 1 Download Total of 43231 occurrences in 144 samples: ASV table 48 version 2 Download Total of 43231 occurrences in 144 samples: ASV table 48 version 3 Download Total of 43231 occurrences in 144 samples: ASV table 48 version 4 Download Total of 43231 occurrences in 144 samples: ASV table 48 version 5 Download Total of 43231 occurrences in 144 samples: ASV table 48 version 6 Download Total of 43231 occurrences in 144 samples: ASV table 121 version 1 Download |