ASV Sequence GBOL_ASV_ID_66852

Date added 2022-08-12 14:45:18
Provided in projects: Project: Björns Testprojekt with original sequence id: OTU_146
Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66852
Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_146
Primers

TCCTTTATCTTCAGGAATTGCACATGCAGGGGCTTCTGTTGACTTAGCAATTTTTTCATTACATCTTGCAGGTATTTCCTCTATTTTAGGGGCTGTAAATTTTATTACAACAGTAATTAATATACGATCAGATGGGATTACTTTAGATCGAATACCTTTATTTGTCTGATCAGTTGTAATTACAGCTATTCTTTTACTTCTATCTTTACCAGTATTA

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Cricotopus triannulatus Macquart, 1826 BOLD Arthropoda, Insecta, Diptera, Chironomidae, Orthocladiinae, Cricotopus, Cricotopus triannulatus Macquart, 1826 100.0000 2022-10-20 00:49:26
Cricotopus triannulatus (Macquart, 1826) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Cricotopus, Cricotopus, Cricotopus triannulatus (Macquart, 1826) 100.0000 0E-8 2022-10-28 13:02:41
Cricotopus triannulatus (Macquart, 1826) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Cricotopus, Cricotopus, Cricotopus triannulatus (Macquart, 1826) 100.0000 0E-8 2025-01-16 15:32:25

Occurrences Total of 68317 occurrences in 144 samples: ASV table 11 version 1 Download
Total of 68317 occurrences in 144 samples: ASV table 11 version 2 Download
Total of 68317 occurrences in 144 samples: ASV table 11 version 3 Download
Total of 68317 occurrences in 144 samples: ASV table 48 version 1 Download
Total of 68317 occurrences in 144 samples: ASV table 48 version 2 Download
Total of 68317 occurrences in 144 samples: ASV table 48 version 3 Download
Total of 68317 occurrences in 144 samples: ASV table 48 version 4 Download
Total of 68317 occurrences in 144 samples: ASV table 48 version 5 Download
Total of 68317 occurrences in 144 samples: ASV table 48 version 6 Download
Total of 68317 occurrences in 144 samples: ASV table 121 version 1 Download