ASV Sequence GBOL_ASV_ID_66849
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_137 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66849 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_137 |
| Primers |
CCCTCTATCTTCTGGTATTGCTCATGCCGGTGCTTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGGGCAGTTAACTTTATTACAACGGTAATTAATATACGATCAAATGGTATTACTTTAGACCGAATGCCTTTATTTGTTTGATCAGTTATCATTACCGCTATTTTATTACTATTATCTTTACCGGTTTTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Orthocladius oblidens Walker, 1856 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Orthocladiinae, Orthocladius, Orthocladius oblidens Walker, 1856 | 100.0000 | 2022-10-20 00:49:26 | |
| Orthocladius | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Orthocladius | 100.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Orthocladius oblidens (Walker, 1856) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Orthocladius, Orthocladius, Orthocladius oblidens (Walker, 1856) | 100.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Orthocladius oblidens (Walker, 1856) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Orthocladius, Orthocladius, Orthocladius oblidens (Walker, 1856) | 100.0000 | 0E-8 | 2025-01-16 15:32:25 |
| Occurrences |
Total of 77819 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 77819 occurrences in 144 samples: ASV table 11 version 2 Download Total of 77819 occurrences in 144 samples: ASV table 11 version 3 Download Total of 77819 occurrences in 144 samples: ASV table 48 version 1 Download Total of 77819 occurrences in 144 samples: ASV table 48 version 2 Download Total of 77819 occurrences in 144 samples: ASV table 48 version 3 Download Total of 77819 occurrences in 144 samples: ASV table 48 version 4 Download Total of 77819 occurrences in 144 samples: ASV table 48 version 5 Download Total of 77819 occurrences in 144 samples: ASV table 48 version 6 Download Total of 77819 occurrences in 144 samples: ASV table 121 version 1 Download |