ASV Sequence GBOL_ASV_ID_66845
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_121 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66845 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_121 |
| Primers |
TCCTCTTTCTTCTGGAATTGCTCATGCTGGAGCTTCAGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGTATTTCCTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATGCGGTCAGAAGGAATTACTCTAGATCGAATACCTTTATTTGTATGATCAGTAGTGATTACTGCTGTTTTATTACTTTTATCGTTACCTGTATTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Cricotopus | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Cricotopus | 100.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Cricotopus bicinctus Meigen, 1818 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Orthocladiinae, Cricotopus, Cricotopus bicinctus Meigen, 1818 | 100.0000 | 2022-10-20 00:49:26 | |
| Cricotopus bicinctus (Meigen, 1818) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Cricotopus, Cricotopus, Cricotopus bicinctus (Meigen, 1818) | 100.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Cricotopus bicinctus (Meigen, 1818) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Cricotopus, Cricotopus, Cricotopus bicinctus (Meigen, 1818) | 100.0000 | 0E-8 | 2025-01-16 15:32:25 |
| Occurrences |
Total of 206391 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 206391 occurrences in 144 samples: ASV table 11 version 2 Download Total of 206391 occurrences in 144 samples: ASV table 11 version 3 Download Total of 206391 occurrences in 144 samples: ASV table 48 version 1 Download Total of 206391 occurrences in 144 samples: ASV table 48 version 2 Download Total of 206391 occurrences in 144 samples: ASV table 48 version 3 Download Total of 206391 occurrences in 144 samples: ASV table 48 version 4 Download Total of 206391 occurrences in 144 samples: ASV table 48 version 5 Download Total of 206391 occurrences in 144 samples: ASV table 48 version 6 Download Total of 206391 occurrences in 144 samples: ASV table 121 version 1 Download |