ASV Sequence GBOL_ASV_ID_66843
Date added | 2022-08-12 14:45:18 |
Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_113 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66843 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_113 |
Primers |
CCCTTTATCATCTAATATTGCTCATGCAGGAGCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGGGCAGTAAATTTTATTACAACAGTAATTAATATACGTTCAGCTGGAATTACATTAGATCGAATACCCTTATTTGTTTGATCAGTGGTTATTACAGCTATTTTACTACTTTTATCTTTACCAGTTTTA
Currently, no taxa have been assigned
Occurrences |
Total of 195238 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 195238 occurrences in 144 samples: ASV table 11 version 2 Download Total of 195238 occurrences in 144 samples: ASV table 11 version 3 Download Total of 195238 occurrences in 144 samples: ASV table 48 version 1 Download Total of 195238 occurrences in 144 samples: ASV table 48 version 2 Download Total of 195238 occurrences in 144 samples: ASV table 48 version 3 Download Total of 195238 occurrences in 144 samples: ASV table 48 version 4 Download Total of 195238 occurrences in 144 samples: ASV table 48 version 5 Download Total of 195238 occurrences in 144 samples: ASV table 48 version 6 Download Total of 195238 occurrences in 144 samples: ASV table 121 version 1 Download |