ASV Sequence GBOL_ASV_ID_66839
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_96 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66839 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_96 |
| Primers |
TCCCCTATCTTCTGGGTTAGCCCATGCAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTACATTTAGCGGGTATTTCTTCTATTTTAGGAGCAGTCAATTTTATTACAACAGTTATTAATATACGCTCAGAAGGAATTTCACTTGACCGAATGCCTTTATTTGTTTGATCTGTTATTATTACAGCCGTCTTATTGCTTTTATCCCTCCCCGTCCTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Parametriocnemus stylatus Kieffer, 1924 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Parametriocnemus, Parametriocnemus stylatus Kieffer, 1924 | 100.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Eukiefferiella brevicalcar (Kieffer, 1911) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Eukiefferiella, Eukiefferiella brevicalcar (Kieffer, 1911) | 100.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Eukiefferiella tirolensis Goetghebuer, 1938 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Eukiefferiella, Eukiefferiella tirolensis Goetghebuer, 1938 | 100.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Parametriocnemus stylatus Kieffer, 1924 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Parametriocnemus, Parametriocnemus stylatus Kieffer, 1924 | 100.0000 | 0E-8 | 2025-01-16 15:32:25 |
| Occurrences |
Total of 258753 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 258753 occurrences in 144 samples: ASV table 11 version 2 Download Total of 258753 occurrences in 144 samples: ASV table 11 version 3 Download Total of 258753 occurrences in 144 samples: ASV table 48 version 1 Download Total of 258753 occurrences in 144 samples: ASV table 48 version 2 Download Total of 258753 occurrences in 144 samples: ASV table 48 version 3 Download Total of 258753 occurrences in 144 samples: ASV table 48 version 4 Download Total of 258753 occurrences in 144 samples: ASV table 48 version 5 Download Total of 258753 occurrences in 144 samples: ASV table 48 version 6 Download Total of 258753 occurrences in 144 samples: ASV table 121 version 1 Download |