ASV Sequence GBOL_ASV_ID_66838

Date added 2022-08-12 14:45:18
Provided in projects: Project: Björns Testprojekt with original sequence id: OTU_95
Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66838
Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_95
Primers

TCCCTTATCTTCGGGAATTGCCCACGCAGGGGCCTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCCTCAATTTTAGGGGCTGTAAATTTTATTACAACAGTAATTAATATACGATCAAGAGGAATCACCTTAGATCGAATACCATTATTTGTTTGATCTGTCCTTATTACTGCTGTATTACTACTTTTATCTTTACCAGTTTTA

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Thienemannimyia carnea (Fabricius, 1805) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Thienemannimyia, Thienemannimyia carnea (Fabricius, 1805) 99.0000 0E-8 2022-10-20 00:49:26
Thienemannimyia sp. 1ES BOLD Arthropoda, Insecta, Diptera, Chironomidae, Tanypodinae, Thienemannimyia, Thienemannimyia sp. 1ES 98.0000 2022-10-20 00:49:26
Thienemannimyia carnea (Fabricius, 1805) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Thienemannimyia, Thienemannimyia carnea (Fabricius, 1805) 99.0000 0E-8 2025-01-16 15:32:25

Occurrences Total of 266431 occurrences in 144 samples: ASV table 11 version 1 Download
Total of 266431 occurrences in 144 samples: ASV table 11 version 2 Download
Total of 266431 occurrences in 144 samples: ASV table 11 version 3 Download
Total of 266431 occurrences in 144 samples: ASV table 48 version 1 Download
Total of 266431 occurrences in 144 samples: ASV table 48 version 2 Download
Total of 266431 occurrences in 144 samples: ASV table 48 version 3 Download
Total of 266431 occurrences in 144 samples: ASV table 48 version 4 Download
Total of 266431 occurrences in 144 samples: ASV table 48 version 5 Download
Total of 266431 occurrences in 144 samples: ASV table 48 version 6 Download
Total of 266431 occurrences in 144 samples: ASV table 121 version 1 Download