ASV Sequence GBOL_ASV_ID_66833
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_77 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66833 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_77 |
| Primers |
TCCTCTTTCTTCTGGAATTGCTCACGCCGGAGCTTCAGTAGATCTAGCCATTTTTTCTTTACATCTGGCTGGAATTTCTTCTATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATACGATCAAGTGGAATTACTTTAGATCGTATACCTTTATTTGTTTGATCAGTAGTAATTACTGCAGTGTTATTACTATTATCTTTACCAGTTTTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Conchapelopia | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Conchapelopia | 100.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Conchapelopia pallidula (Meigen, 1818) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Conchapelopia, Conchapelopia pallidula (Meigen, 1818) | 100.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Conchapelopia hittmairorum Michiels & Spies, 2002 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Tanypodinae, Conchapelopia, Conchapelopia hittmairorum Michiels & Spies, 2002 | 100.0000 | 2022-10-20 00:49:26 | |
| Conchapelopia sp. AJ-2011 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Tanypodinae, Conchapelopia, Conchapelopia sp. AJ-2011 | 98.0000 | 2022-10-20 00:49:26 | |
| Chironomidae | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae | 100.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Conchapelopia | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Conchapelopia | 100.0000 | 0E-8 | 2025-01-16 15:32:25 |
| Occurrences |
Total of 258576 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 258576 occurrences in 144 samples: ASV table 11 version 2 Download Total of 258576 occurrences in 144 samples: ASV table 11 version 3 Download Total of 258576 occurrences in 144 samples: ASV table 48 version 1 Download Total of 258576 occurrences in 144 samples: ASV table 48 version 2 Download Total of 258576 occurrences in 144 samples: ASV table 48 version 3 Download Total of 258576 occurrences in 144 samples: ASV table 48 version 4 Download Total of 258576 occurrences in 144 samples: ASV table 48 version 5 Download Total of 258576 occurrences in 144 samples: ASV table 48 version 6 Download Total of 258576 occurrences in 144 samples: ASV table 121 version 1 Download |