ASV Sequence GBOL_ASV_ID_66817

Date added 2022-08-12 14:45:18
Provided in projects: Project: Björns Testprojekt with original sequence id: OTU_341
Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66817
Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_341
Primers

CCCCTTAGCTAGAAATATTGCTCATATAGGAAGATCAGTTGATTTATCTATTTTTTCATTACATATAGCCGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATAAGAATAAAACCTAAAAGAATACTATTAGATCAAATACCTCTTTTTGTATGATCTGTAGGAATTACTGCGCTACTACTACTCCTATCCCTACCGGTATTA

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Ceraclea dissimilis (Stephens, 1836) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Trichoptera, Leptoceridae, Ceraclea, Ceraclea dissimilis (Stephens, 1836) 100.0000 0E-8 2022-10-20 00:49:26
Ceraclea dissimilis Stephens, 1836 BOLD Arthropoda, Insecta, Trichoptera, Leptoceridae, Leptocerinae, Ceraclea, Ceraclea dissimilis Stephens, 1836 100.0000 2022-10-20 00:49:26
Ceraclea riparia Albarda, 1874 BOLD Arthropoda, Insecta, Trichoptera, Leptoceridae, Leptocerinae, Ceraclea, Ceraclea riparia Albarda, 1874 100.0000 2022-10-20 00:49:26
Ceraclea dissimilis (Stephens, 1836) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Trichoptera, Leptoceridae, Ceraclea, Ceraclea dissimilis (Stephens, 1836) 100.0000 0E-8 2025-01-16 15:32:25

Occurrences Total of 4173 occurrences in 144 samples: ASV table 11 version 1 Download
Total of 4173 occurrences in 144 samples: ASV table 11 version 2 Download
Total of 4173 occurrences in 144 samples: ASV table 11 version 3 Download
Total of 4173 occurrences in 144 samples: ASV table 48 version 1 Download
Total of 4173 occurrences in 144 samples: ASV table 48 version 2 Download
Total of 4173 occurrences in 144 samples: ASV table 48 version 3 Download
Total of 4173 occurrences in 144 samples: ASV table 48 version 4 Download
Total of 4173 occurrences in 144 samples: ASV table 48 version 5 Download
Total of 4173 occurrences in 144 samples: ASV table 48 version 6 Download
Total of 4173 occurrences in 144 samples: ASV table 121 version 1 Download