ASV Sequence GBOL_ASV_ID_66816
Date added | 2022-08-12 14:45:18 |
Provided in projects: |
Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_140 |
Primers |
TCCGTTAGCTGCAAATATTGCTCATACGGGGAGATCTGTAGATTTATCTATTTTTTCTTTACATATAGCAGGCATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACAATTATAAGAATAAAACCTAAAAGAATACTATTAGACCAAATACCCCTATTTGTTTGGTCTGTGGGAATTACAGCCCTATTACTACTTTTATCATTACCTGTATTA
Currently, no taxa have been assigned
Occurrences |
Total of 70003 occurrences in 144 samples:
ASV table 48 version 1 Download
Total of 70003 occurrences in 144 samples: ASV table 121 version 1 Download |