ASV Sequence GBOL_ASV_ID_66816
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_140 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66816 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_140 |
| Primers |
TCCGTTAGCTGCAAATATTGCTCATACGGGGAGATCTGTAGATTTATCTATTTTTTCTTTACATATAGCAGGCATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACAATTATAAGAATAAAACCTAAAAGAATACTATTAGACCAAATACCCCTATTTGTTTGGTCTGTGGGAATTACAGCCCTATTACTACTTTTATCATTACCTGTATTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Ceraclea nigronervosa (Retzius, 1783) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Trichoptera, Leptoceridae, Ceraclea, Ceraclea nigronervosa (Retzius, 1783) | 98.0000 | 0E-8 | 2022-10-19 23:34:48 |
| Ceraclea nigronervosa Retzius, 1783 | BOLD | Arthropoda, Insecta, Trichoptera, Leptoceridae, Leptocerinae, Ceraclea, Ceraclea nigronervosa Retzius, 1783 | 98.0000 | 2022-10-20 00:49:26 |
| Occurrences |
Total of 70003 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 70003 occurrences in 144 samples: ASV table 11 version 2 Download Total of 70003 occurrences in 144 samples: ASV table 11 version 3 Download Total of 70003 occurrences in 144 samples: ASV table 48 version 1 Download Total of 70003 occurrences in 144 samples: ASV table 48 version 2 Download Total of 70003 occurrences in 144 samples: ASV table 48 version 3 Download Total of 70003 occurrences in 144 samples: ASV table 48 version 4 Download Total of 70003 occurrences in 144 samples: ASV table 48 version 5 Download Total of 70003 occurrences in 144 samples: ASV table 48 version 6 Download Total of 70003 occurrences in 144 samples: ASV table 121 version 1 Download |