ASV Sequence GBOL_ASV_ID_66816

Date added 2022-08-12 14:45:18
Provided in projects: Project: Björns Testprojekt with original sequence id: OTU_140
Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66816
Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_140
Primers

TCCGTTAGCTGCAAATATTGCTCATACGGGGAGATCTGTAGATTTATCTATTTTTTCTTTACATATAGCAGGCATTTCTTCAATTTTAGGGGCTATTAATTTTATTACAACAATTATAAGAATAAAACCTAAAAGAATACTATTAGACCAAATACCCCTATTTGTTTGGTCTGTGGGAATTACAGCCCTATTACTACTTTTATCATTACCTGTATTA

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Ceraclea nigronervosa (Retzius, 1783) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Trichoptera, Leptoceridae, Ceraclea, Ceraclea nigronervosa (Retzius, 1783) 98.0000 0E-8 2022-10-19 23:34:48
Ceraclea nigronervosa Retzius, 1783 BOLD Arthropoda, Insecta, Trichoptera, Leptoceridae, Leptocerinae, Ceraclea, Ceraclea nigronervosa Retzius, 1783 98.0000 2022-10-20 00:49:26

Occurrences Total of 70003 occurrences in 144 samples: ASV table 11 version 1 Download
Total of 70003 occurrences in 144 samples: ASV table 11 version 2 Download
Total of 70003 occurrences in 144 samples: ASV table 11 version 3 Download
Total of 70003 occurrences in 144 samples: ASV table 48 version 1 Download
Total of 70003 occurrences in 144 samples: ASV table 48 version 2 Download
Total of 70003 occurrences in 144 samples: ASV table 48 version 3 Download
Total of 70003 occurrences in 144 samples: ASV table 48 version 4 Download
Total of 70003 occurrences in 144 samples: ASV table 48 version 5 Download
Total of 70003 occurrences in 144 samples: ASV table 48 version 6 Download
Total of 70003 occurrences in 144 samples: ASV table 121 version 1 Download