ASV Sequence GBOL_ASV_ID_66815

Date added 2022-08-12 14:45:18
Provided in projects: Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_248
Primers

CCCCTTAGCTAGCAACATCGCCCACATAGGTAGATCAGTCGATTTATCAATTTTCTCCCTTCATATGGCCGGAATTTCTTCTATTCTAGGGGCCATTAATTTTATTACCACAATCATAAGAATAAAGCCCAAAAGAATACTATTAGACCAAATACCTCTTTTTGTATGATCCGTAGGCATTACTGCATTATTGCTACTTTTATCTTTACCAGTATTA

Currently, no taxa have been assigned

Occurrences Total of 26261 occurrences in 144 samples: ASV table 48 version 1 Download
Total of 26261 occurrences in 144 samples: ASV table 121 version 1 Download