ASV Sequence GBOL_ASV_ID_66803
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_75 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66803 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_75 |
| Primers |
ACCCCTATCAAGAAATTTAACACATAGAGGGGCATCTGTAGATCTAGCAATCTTCTCTTTACACCTGGCGGGTGTATCATCAATTTTAGGTGCCATCAATTTTATCTCAACTATTATTAATATGCGAGTTATAGGAATAACTCCTGAACGGACTCCATTATTTGTATGGTCAGTAGGTATTACTGCACTACTTTTACTTTTATCTTTACCAGTATTG
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Callicorixa praeusta (Fieber, 1848) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Heteroptera, Corixidae, Callicorixa, Callicorixa praeusta (Fieber, 1848) | 99.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Callicorixa praeusta (Fieber, 1848) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Heteroptera, Corixidae, Callicorixa, Callicorixa praeusta (Fieber, 1848) | 97.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Callicorixa producta Reuter, 1880 | BOLD | Arthropoda, Insecta, Hemiptera, Corixidae, Corixinae, Callicorixa, Callicorixa producta Reuter, 1880 | 98.0000 | 2022-10-20 00:49:26 | |
| Callicorixa wollastoni | BOLD | Arthropoda, Insecta, Hemiptera, Corixidae, Corixinae, Callicorixa, Callicorixa wollastoni | 98.0000 | 2022-10-20 00:49:26 | |
| Callicorixa audeni Hungerford, 1928 | BOLD | Arthropoda, Insecta, Hemiptera, Corixidae, Corixinae, Callicorixa, Callicorixa audeni Hungerford, 1928 | 98.0000 | 2022-10-20 00:49:26 | |
| Callicorixa praeusta (Fieber, 1848) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Paraneoptera, Hemiptera, Heteroptera, Corixidae, Callicorixa, Callicorixa praeusta (Fieber, 1848) | 99.0000 | 0E-8 | 2025-01-16 15:32:25 |
| Occurrences |
Total of 481316 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 481316 occurrences in 144 samples: ASV table 11 version 2 Download Total of 481316 occurrences in 144 samples: ASV table 11 version 3 Download Total of 481316 occurrences in 144 samples: ASV table 48 version 1 Download Total of 481316 occurrences in 144 samples: ASV table 48 version 2 Download Total of 481316 occurrences in 144 samples: ASV table 48 version 3 Download Total of 481316 occurrences in 144 samples: ASV table 48 version 4 Download Total of 481316 occurrences in 144 samples: ASV table 48 version 5 Download Total of 481316 occurrences in 144 samples: ASV table 48 version 6 Download Total of 481316 occurrences in 144 samples: ASV table 121 version 1 Download |