ASV Sequence GBOL_ASV_ID_66779
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_192 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66779 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_192 |
| Primers |
TCCTTTAGCGGCCAATATCGCCCATGGGGGTTCGTCAGTAGATTTTGCTATTTTTTCCTTGCATTTGGCTGGGGTTTCTTCTATTTTAGGCGCAGTAAATTTTATCACAACTGTTGTTAATATACGTAGCCCAGGTATAACTCTAGATCGAATACCTCTATTTGTTTGGTCGGTAGTGATTACTGCCGTCCTGTTATTGCTTTCGTTACCCGTGTTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Baetis sp. MZH_JV15 | BOLD | Arthropoda, Insecta, Ephemeroptera, Baetidae, Baetinae, Baetis, Baetis sp. MZH_JV15 | 100.0000 | 2022-10-20 00:49:26 | |
| Baetis sp. MZH_JV13 | BOLD | Arthropoda, Insecta, Ephemeroptera, Baetidae, Baetinae, Baetis, Baetis sp. MZH_JV13 | 100.0000 | 2022-10-20 00:49:26 | |
| Baetis sp. MZH_ES135 | BOLD | Arthropoda, Insecta, Ephemeroptera, Baetidae, Baetinae, Baetis, Baetis sp. MZH_ES135 | 100.0000 | 2022-10-20 00:49:26 | |
| Baetis sp. MZH_ES128 | BOLD | Arthropoda, Insecta, Ephemeroptera, Baetidae, Baetinae, Baetis, Baetis sp. MZH_ES128 | 100.0000 | 2022-10-20 00:49:26 | |
| Baetis sp. MZH_JV14 | BOLD | Arthropoda, Insecta, Ephemeroptera, Baetidae, Baetinae, Baetis, Baetis sp. MZH_JV14 | 100.0000 | 2022-10-20 00:49:26 |
| Occurrences |
Total of 19156 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 19156 occurrences in 144 samples: ASV table 11 version 2 Download Total of 19156 occurrences in 144 samples: ASV table 11 version 3 Download Total of 19156 occurrences in 144 samples: ASV table 48 version 1 Download Total of 19156 occurrences in 144 samples: ASV table 48 version 2 Download Total of 19156 occurrences in 144 samples: ASV table 48 version 3 Download Total of 19156 occurrences in 144 samples: ASV table 48 version 4 Download Total of 19156 occurrences in 144 samples: ASV table 48 version 5 Download Total of 19156 occurrences in 144 samples: ASV table 48 version 6 Download Total of 19156 occurrences in 144 samples: ASV table 121 version 1 Download |