ASV Sequence GBOL_ASV_ID_66776
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_26 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66776 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_26 |
| Primers |
CCTTTAGCTGCCAATATTGCCCACGGAGGGTCTTCTGTAGATTTTGCTATTTTTTCATTGCATTTGGCTGGAATTTCATCAATTTTGGGAGCGGTAAATTTTATTACTACGGTAATTAATATACGAAGACCTGGAATAAGCTTAGACCGAATACCCCTATTTGTCTGGTCAGTGGTAATTACAGCGGTTTTATTATTGTTATCTTTGCCTGTGTTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Baetis niger (Linnaeus, 1761) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Ephemeroptera, Baetidae, Baetis, Baetis niger (Linnaeus, 1761) | 100.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Nigrobaetis niger Linnaeus, 1761 | BOLD | Arthropoda, Insecta, Ephemeroptera, Baetidae, Baetinae, Nigrobaetis, Nigrobaetis niger Linnaeus, 1761 | 100.0000 | 2022-10-20 00:49:26 | |
| Baetis niger (Linnaeus, 1761) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Ephemeroptera, Baetidae, Baetis, Baetis niger (Linnaeus, 1761) | 100.0000 | 0E-8 | 2025-01-16 15:32:25 |
| Occurrences |
Total of 3056880 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 3056880 occurrences in 144 samples: ASV table 11 version 2 Download Total of 3056880 occurrences in 144 samples: ASV table 11 version 3 Download Total of 3056880 occurrences in 144 samples: ASV table 48 version 1 Download Total of 3056880 occurrences in 144 samples: ASV table 48 version 2 Download Total of 3056880 occurrences in 144 samples: ASV table 48 version 3 Download Total of 3056880 occurrences in 144 samples: ASV table 48 version 4 Download Total of 3056880 occurrences in 144 samples: ASV table 48 version 5 Download Total of 3056880 occurrences in 144 samples: ASV table 48 version 6 Download Total of 3056880 occurrences in 144 samples: ASV table 121 version 1 Download |