ASV Sequence GBOL_ASV_ID_66766
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_45 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66766 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_45 |
| Primers |
CCCACTAGCTGCAAGTATGGCACACAGGGGTCCTTCTGTAGATTTAGGAATTTTTTCTTTACACTTAGCCGGGGCTAGTTCTATTCTAGGCTCTGTTAATTTTATCTCAACAGTTATTAATATACGCGCAGAGGGCGTAAGATTCGATAAGGTTCCTTTGTTTGTGTGGTCAGTATTTTTAACTACTATTTTACTTCTACTTTCTCTACCTGTGTTA
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Asellus aquaticus Linnaeus, 1758 | BOLD | Arthropoda, Malacostraca, Isopoda, Asellidae, Asellus, Asellus aquaticus Linnaeus, 1758 | 99.0000 | 2022-10-20 00:49:26 | |
| Asellus aquaticus Linnaeus, 1758 | BOLD | Arthropoda, Malacostraca, Isopoda, Asellidae, Asellus, Asellus aquaticus Linnaeus, 1758 | 100.0000 | 2022-10-20 00:49:26 | |
| Asellus aquaticus (Linnaeus, 1758) | GBOL | Animalia, Arthropoda, Crustacea, Malacostraca, Isopoda, Asellidae, Asellus, Asellus aquaticus (Linnaeus, 1758) | 95.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Asellus aquaticus (Linnaeus, 1758) | GBOL | Animalia, Arthropoda, Crustacea, Malacostraca, Isopoda, Asellidae, Asellus, Asellus aquaticus (Linnaeus, 1758) | 97.0000 | 0E-8 | 2022-10-28 13:02:41 |
| Occurrences |
Total of 818312 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 818312 occurrences in 144 samples: ASV table 11 version 2 Download Total of 818312 occurrences in 144 samples: ASV table 11 version 3 Download Total of 818312 occurrences in 144 samples: ASV table 48 version 1 Download Total of 818312 occurrences in 144 samples: ASV table 48 version 2 Download Total of 818312 occurrences in 144 samples: ASV table 48 version 3 Download Total of 818312 occurrences in 144 samples: ASV table 48 version 4 Download Total of 818312 occurrences in 144 samples: ASV table 48 version 5 Download Total of 818312 occurrences in 144 samples: ASV table 48 version 6 Download Total of 818312 occurrences in 144 samples: ASV table 121 version 1 Download |