ASV Sequence GBOL_ASV_ID_66761
Date added | 2022-08-12 14:45:18 |
Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_109 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66761 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_109 |
Primers |
TCCTTTAAGAGGATCTATTGCTCATAGTGGCGCTTCTGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGGATATCATCTATTTTAGGAGCAATTAATTTTATTACAACGATTTTTAATATACGTGCTCCTGGAATTACTATGGAACGTCTTTCCTTATTTGTTTGATCAATTTTAATTACAGCGTTTTTATTATTATTATCGTTACCGGTATTA
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Ancylus fluviatilis O.F. Müller, 1774 | GBOL | Animalia, Mollusca, Gastropoda, Planorbidae, Ancylus, Ancylus fluviatilis O.F. Müller, 1774 | 100.0000 | 0E-8 | 2022-10-20 00:49:26 |
Ancylus | GBOL | Animalia, Mollusca, Gastropoda, Ancylidae, Ancylus | 99.0000 | 0E-8 | 2022-10-20 00:49:26 |
Ancylus fluviatilis Müller, 1774 | GBOL | Animalia, Mollusca, Gastropoda, Ancylidae, Ancylus, Ancylus fluviatilis Müller, 1774 | 99.0000 | 0E-8 | 2022-10-20 00:49:26 |
Ancylus fluviatilis Müller, 1774 | BOLD | Mollusca, Gastropoda, Pulmonata, Ancylidae, Ancylus, Ancylus fluviatilis Müller, 1774 | 99.0000 | 2022-10-20 00:49:26 | |
Ancylus sp. H5 | BOLD | Mollusca, Gastropoda, Pulmonata, Ancylidae, Ancylus, Ancylus sp. H5 | 100.0000 | 2022-10-20 00:49:26 | |
Ancylus sp. H6 | BOLD | Mollusca, Gastropoda, Pulmonata, Ancylidae, Ancylus, Ancylus sp. H6 | 100.0000 | 2022-10-20 00:49:26 | |
Ancylus fluviatilis O.F. Müller, 1774 | GBOL | Animalia, Mollusca, Gastropoda, Planorbidae, Ancylus, Ancylus fluviatilis O.F. Müller, 1774 | 100.0000 | 0E-8 | 2025-01-16 15:32:25 |
Occurrences |
Total of 175513 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 175513 occurrences in 144 samples: ASV table 11 version 2 Download Total of 175513 occurrences in 144 samples: ASV table 11 version 3 Download Total of 175513 occurrences in 144 samples: ASV table 48 version 1 Download Total of 175513 occurrences in 144 samples: ASV table 48 version 2 Download Total of 175513 occurrences in 144 samples: ASV table 48 version 3 Download Total of 175513 occurrences in 144 samples: ASV table 48 version 4 Download Total of 175513 occurrences in 144 samples: ASV table 48 version 5 Download Total of 175513 occurrences in 144 samples: ASV table 48 version 6 Download Total of 175513 occurrences in 144 samples: ASV table 121 version 1 Download |