ASV Sequence GBOL_ASV_ID_66759
| Date added | 2022-08-12 14:45:18 |
| Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_176 Project: Björns Testprojekt with original sequence id: GBOL_ASV_ID_66759 Project: Assessing strengths and weaknesses of metabarcoding for stream monitoring with original sequence id: OTU_176 |
| Primers |
TCCACTTTCCTCTACTATTGCTCATATCGGGGGATCTGTTGACTTATCAATTTTTTCATTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCAGTAAATTTTATTTCAACAATAATTAATATACGATCAAATAGAATAACAATAGAAAAAATACCACTTTTTGTATGGTCTGTATTTATTACAGCTATTCTTTTGTTGCTTTCCCTTCCTGTACTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Agapetus ochripes Curtis, 1834 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Trichoptera, Glossosomatidae, Agapetus, Agapetus ochripes Curtis, 1834 | 100.0000 | 0E-8 | 2022-10-20 00:49:26 |
| Agapetus ochripes Curtis, 1834 | BOLD | Arthropoda, Insecta, Trichoptera, Glossosomatidae, Agapetinae, Agapetus, Agapetus ochripes Curtis, 1834 | 100.0000 | 2022-10-20 00:49:26 | |
| Agapetus ochripes Curtis, 1834 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Trichoptera, Glossosomatidae, Agapetus, Agapetus ochripes Curtis, 1834 | 100.0000 | 0E-8 | 2025-01-16 15:32:25 |
| Occurrences |
Total of 30992 occurrences in 144 samples:
ASV table 11 version 1 Download
Total of 30992 occurrences in 144 samples: ASV table 11 version 2 Download Total of 30992 occurrences in 144 samples: ASV table 11 version 3 Download Total of 30992 occurrences in 144 samples: ASV table 48 version 1 Download Total of 30992 occurrences in 144 samples: ASV table 48 version 2 Download Total of 30992 occurrences in 144 samples: ASV table 48 version 3 Download Total of 30992 occurrences in 144 samples: ASV table 48 version 4 Download Total of 30992 occurrences in 144 samples: ASV table 48 version 5 Download Total of 30992 occurrences in 144 samples: ASV table 48 version 6 Download Total of 30992 occurrences in 144 samples: ASV table 121 version 1 Download |