ASV Sequence GBOL_ASV_ID_66650

Date added 2022-08-02 06:12:02
Provided in projects: Project: DSUB-558 with original sequence id: P142690-1702
Project: Introduction asv registry with original sequence id: P142690-1702
Primers
mlCOIintF, dgHCO2198

CCTATCCTCTAATATTGCTCATGGAGGGGCTTCTGTCGATTTAGCAATTTTCTCATTACATTTAGCGGGAATTTCATCAATTCTAGGAGCAGTAAATTTTATTACCACAGTAATTAATATACGATCTACAGGTATTACCTTCGATCGAATACCTTTATTTGTATGATCGGTAGTAATTACCGCCTTATTATTACTTCTTTCTTTGCCAGTACTTGCAGGAGCTATTACAATGCTATTAACTGATCGAAATATTAATACTTCTTTCTTTGACCCTGCAGGAGGAGGAGACCCCATTCTTTATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Blaesoxipha_plumicornis from ASV table 170 Arthropoda, Insecta, Diptera, Sarcophagidae, Blaesoxipha, Blaesoxipha_plumicornis 2025-12-04 23:59:38
Blaesoxipha plumicornis (Zetterstedt, 1859) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Sarcophagidae, Blaesoxipha, Blaesoxipha plumicornis (Zetterstedt, 1859) 100.0000 0E-8 2025-12-05 00:00:47

Occurrences Total of 206 occurrences in 63 samples: ASV table 154 version 1 Download
Total of 0 occurrences in 63 samples: ASV table 170 version 1 Download