ASV Sequence GBOL_ASV_ID_56567

Date added 2022-08-02 06:12:02
Provided in projects: Project: DSUB-558 with original sequence id: P142690-1923
Project: Introduction asv registry with original sequence id: P142690-2025-4450
Project: Introduction asv registry with original sequence id: P142690-1923
Project: smf_dummy with original sequence id: P142690-2025-4450
Primers
mlCOIintF, dgHCO2198

ATTATCAACTGACGGTCATTCAGGGCCTTCAGTTGATATATCAATTTTTTCATTACATATAGCTGGGATTAGATCTATTATAGGATCAATTAATTTTATTTCAACAATTATTAATATAAAAATTTTTAAAATAGAAATAATTTCTTTATTTCCTTGATCAATATTATTAACTGCAATTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTATTTGATCGAAATATAAATACTTCATTTTTTGATCCTATAGGTGGTGGAGATCCTATTTTATATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Haltichella_rufipes from ASV table 168 Arthropoda, Insecta, Hymenoptera, Chalcididae, Haltichella, Haltichella_rufipes 2025-12-03 13:23:57
Haltichella_rufipes from ASV table 170 Arthropoda, Insecta, Hymenoptera, Chalcididae, Haltichella, Haltichella_rufipes 2025-12-04 23:59:38
Haltichella rufipes (Olivier, 1791) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Chalcididae, Haltichella, Haltichella rufipes (Olivier, 1791) 100.0000 0E-8 2025-12-05 00:00:47

Occurrences Total of 11 occurrences in 63 samples: ASV table 154 version 1 Download
Total of 2410 occurrences in 98 samples: ASV table 160 version 1 Download
Total of 2410 occurrences in 98 samples: ASV table 168 version 1 Download
Total of 0 occurrences in 63 samples: ASV table 170 version 1 Download
Total of 2410 occurrences in 98 samples: ASV table 173 version 1 Download